Analisis de secuencia

Solo disponible en BuenasTareas
  • Páginas : 8 (1814 palabras )
  • Descarga(s) : 0
  • Publicado : 31 de agosto de 2010
Leer documento completo
Vista previa del texto
Tutorial 1 Análisis de secuencias

EJERCICIOS.

Ejercicio 1. Identificación del segmento de DNA. 1. Traducir el fragmento: http://ca.expasy.org/tools/dna.html Sugerencia: fijarse en el formato de “output”, seleccionar “compact”. Se obtendrán 6 posibles secuencias de aminoácidos, correspondientes a los 6 marcos de lectura (3 en sentido directo y 3 en sentido reverso). No se sabe a priori cuálde las traducciones es la correcta, por lo tanto se debe comparar cada una de ellas con secuencias conocidas disponibles en bases de datos de proteínas. Como criterio adicional, se pueden descartar aquellas traducciones que contengan codones de paro dentro de la secuencia problema, ya que se trata de segmentos cortos que corresponden a ESTs. Secuencia: Traducción a) 5'3' Frame 1: b) 5'3' Frame2: c) 5'3' Frame 3: d) 3'5' Frame 1: e) 3'5' Frame 2: f) 3'5' Frame 3: LELVA-ARVP WSWWRRQEC GAGGVGKSA RHSCLRHQLQ GTLAYATSS ALLPTPPAP ttggagctggtggcgtaggcaagagtgcct

Pregunta: ¿cuántas traducciones (posibles secuencias) considerará Ud. en su análisis? ¿Descartó alguna de ellas a priori? En caso afirmativo, indique la razón. R.- Considerare todas las que no proponen un stop codon en el medio de lasecuencia, o sea de las 6 obtenidas descarte a priori las que presentan una ó más secuencias stop (-), por lo tanto analice 5 secuencias (b-f).

2.

Determinar la pauta de lectura correcta mediante comparación con secuencias de proteínas en bases de datos compuestas (UniProtKB), utilizando la herramienta BLAST: http://www.expasy.ch/tools/blast/ Se debe comparar cada secuencia traducida conlas secuencias conocidas disponibles en bases de datos. Esta es la forma más segura para determinar la traducción correcta de un segmento de DNA problema. 1: ttggagctggtggcgtaggcaagagtgcct a.- LELVA-ARVP: NO HITS FOUND b.- WSWWRRQEC
tr A8M5P4 _SALAI Putative uncharacterized protein [Sare_2777] [Sa... Score: 32 Evalue: 11 (MATRIX PAM30) sp Q9V589 OR45B_DROME Putative odorant receptor 45b [Or45b][Dro... Score: 31 Evalue: 15 (PAM30)

c.- GAGGVGKSA:
sp Q5BJQ5 RIT2_RAT GTP-binding protein Rit2 [Rit2] [Rattus norve... Score: 27 Evalue: 277 (PAM30)

d.- RHSCLRHQLQ:
tr D6U2K4 _9CHLR Putative uncharacterized protein [Krac_1613] [Kt... Score: 29 Evalue: 95 (PAM30)

e.- GTLAYATSS:
tr C7P3D2 _HALMD VanZ family protein precursor [Hmuk_1489] [Halom... Score: 27 Evalue: 371 (PAM30)f.-ALLPTPPAP:
tr Q91954 _CHICK Gallus gallus (Fragment) [Gallus gallus (Chicken)] Score: 28 Evalue: 114 (PAM30)

Pregunta: ¿Cuántas pautas de lectura correctas encontró? ¿Será posible encontrar un número diferente de pautas correctas? Justifique. R.- Encontré 0 pautas correctas en 100%, solo pautas con valores E desde 11, pero con orígenes basados en proteínas no nativas. La mas cercana a unproteína existente en la naturaleza fue un receptor putativo de odorantes (Q9V589), con un valor E de 15 y un score de 31. Para esta secuencia no fue posible encontrar mas secuencias de proteínas con un valor E igual o menor que Q9V589, y para la evaluación de la
búsqueda no se utilizó ningún parámetro de restricción, por lo tanto la única manera de modificar el numero de hallazgos parciales (por elalto valor E) seria activando las restricciones y con ello se disminuirá el número de secuencias encontradas.

3.

Identificación de la secuencia mediante búsqueda en base de datos SwissProt y NRDB, utilizando las herramientas BLAST: http://www.ncbi.nlm.nih.gov/blast/) Hacer búsquedas con las siguientes herramientas: 1) NRDB-Blastp (Max Score, Total Score, Query coverage, Evalue)YP_001537603.1
hypothetical protein Sare_2777 [Salinispora arenicola CNS-205] >gb|ABV98612.1| conserved hypothetical protein [Salinispora arenicola CNS-205]

31.6 31.6 88% 11

XP_002080770.1
GD10662 [Drosophila simulans] >gb|EDX06355.1| GD10662 [Drosophila simulans]

31.2 31.2 88% 15

XP_002089804.1
GE19285 [Drosophila yakuba] >gb|EDW89516.1| GE19285 [Drosophila yakuba]

31.2 31.2 88% 15...
tracking img