Bioinformatic

Solo disponible en BuenasTareas
  • Páginas : 3 (528 palabras )
  • Descarga(s) : 0
  • Publicado : 21 de agosto de 2012
Leer documento completo
Vista previa del texto
a
UNIVERSIDAD DEL TOLIMA
FACULTAD DE CIENCIAS
DEPARTAMENTO DE BIOLOGÍA

María Juliana Vargas Naranjo
Código: 070100202010

CURSO SOBRE “INTRODUCCIÓN A LA BIONFORMÁTICA”COMPROBAR ALINEAMIENTO DE SECUENCIAS POR CLUSTAL W
Articulo: Identification, Characterization, and Effects of Xenopus laevis PNAS-4 Gene on Embryonic Development

Comparación

Primeraparte

Segunda parte
* Selección de las secuencias:

>gi|148299179|gb|EF576840.1| Trypanosoma cruzi strain P/217 clone 1 trans-spliced leader SL mini-exonrepeat region
TTCTGTACTATATTGGTACGCGAAGCTTCCAAATCCGCGAGTCGCGGTTATGTTTGGTCAATTTCTTTTG
GCCGGGGTCCACGGATCCTTTTTTTTTTTTTTTTTTTTTTTTTATATGGTGGTGCCCTCCCATACATATATATATACACACACCTGCAGGCACACGTGTGTGTATGTATGTATGTGCCCCACGCACCCCCGGCTCCTTCA
TGTTTGTGTCGTCGCTGCCCTTGTCTGCGCAAGCACGGTGTCCTGTCTTGTCCGTCTCGCTGCTTTGTGTTCTCGCACTCCACCGCGTGTTTTACGGCGTTGCCTGCGTTTTTTGGTGTTTTTTTGCTTTTTTCCCGTCT
CTTGGCTTCTCGCACTGAACCGCGTGCATACACCGCTCCGCACGCATTAGTCGCGTGTGTTCCGCCCCCCGACACTTTCTGTGGCGCTGATCGGGGGCGACTTCCTGGCCCGGGGACACCCAGTGTGGCCTGGGAGGGGG
GGAGTTTTGTACACTGGCCCGGTATCGCAAAAAAACCCCTCATCTAACTCGAAAACGGTGCGGGCACGGA
ACCTTTTCAACT>gi|148299180|gb|EF576841.1| Trypanosoma cruzi strain P/217 clone 2 trans-spliced leader SL mini-exon repeat regionTTCTGTACTATATTGGTACGCGAAGCTTCCAAATCCGCGAGTCGCGGTTATGTTTGGTCAATTTCTTTTG
GCCGGGGTCCACGGACCCTTTTTTTTTTTTTTTTTTTATTATATATGGTGGTGCCCTCCCATACATATATATATACACACCTGCAGGCACACGTGTGTGTATGTATGTATGTGCCCCACGCACCCCCGGCTCCTTCATGT
TTGTGTCGTCGCTGCCCTTGTCTGCGCAAGCACGGTGTCCTGTCTTGTCCGTCTCGCTGCTTTGTGTTCT
CGCACTCCACCGCGTGTTTTACGGCGTTGCCTGCGTTTTTTGGTGTTTTTTGCTTTTTTCCCGTCTTTTG...
tracking img