Biologia celular y moleculas

Solo disponible en BuenasTareas
  • Páginas : 2 (493 palabras )
  • Descarga(s) : 0
  • Publicado : 9 de septiembre de 2012
Leer documento completo
Vista previa del texto
Biología Celular y Molecular
Cuestionario de la Replicación del ADN
Biotecnología

06/12/2011
UNIVERSIDAD POLITÉCNICA DE QUINTANA ROO
Castañeda Valle Tadeo Maximiliano
Doc. Verónica Vizcaíno1.- Se encontró que un fragmento de un polipéptido producido por el fago T4 tenía la siguiente secuencia de aminoácidos.
Lys-Ser-Pro-Ser-Leu-Asn-Ala
a)
DNA AAA-AGT-CCT-AGT-CCT-AAT-GCTmRNA AAA-UCA-GGA-UCA-GGA-UUA-CGA |

La delección de un solo nucleótido en un sitio de la hebra molde de DNA de T4 y un inserción de un nucleótido distinto en un sitio próximo cambio lasecuencia a:
Lys-Val-His-His-Leu-Met-Ala
b)
DNA TTT-CAA-GTA-GTG-CCT-TAC- GCT mRNA AAA-GUU-CAU-CAC-GGA -AUG- CGA |

c)
Se insertaron: GUU, CAU, CAC, AUGSedeseleccionaron: UCA, GGA, UCA, UUA |

a) ¿Cuál es la secuencia de nucleótidos del fragmento de DNA y RNAm que codifican ese fragmento en el polipéptido original?
b) Cuál es la secuenciade nucleótidos del fragmento de DNA y RNAm que codifican el fragmento mutante?
c) Podría determinar que nucleótido se han insertado y delecionado? Explica porque.
R= para decodificar los genescorrespondientes.

2.- La siguiente secuencia corresponde a un pequeño fragmento de DNA real:
3´ AATTATACACGATGAAGCTTGTGACAGGGTTTCCAATCATTAA 5´
a) mRNA: 3’AAUUAUACACGAUGAAGCUUGUGACAGGGUUUCCAAUCAUUAA 5’

b) 5´ TTAATATGTGCTACTTCGAACACTGTCCCAAAGGTTAGTAATT 3´
a) mRNA: 5´ UUAAUAUGUGCUACUUCGAACACUGUCCCAAAGGUUAGUAAU 3´
a) Indique las dos moléculas de RNA quepodrían ser transcritas a partir de este DNA?
b) Solo una de estas dos moléculas podrían ser transcritas realmente. Explique el porqué.
R= La segunda, porque la primera secuencia 3’ a 5’contiene 2 codones de terminación (UGA) que interrumpen la transcripción. Además la primera secuencia cumple con el marco de lectura completo, o sea, se puede identificar la metionina como codón de...
tracking img