Enzimas de restricción

Solo disponible en BuenasTareas
  • Páginas : 3 (707 palabras )
  • Descarga(s) : 0
  • Publicado : 8 de junio de 2011
Leer documento completo
Vista previa del texto
1. ¿Qué son las enzimas de restricción (ER) y de donde se obtienen?
Son enzimas que cortan enlaces fosfodiester del material genético a partir de cierta secuencia que reconocen. La acción de cortede una enzima de restricción genera fragmentos específicos de DNA llamados fragmentos de restricción.
2. ¿De qué manera las bacterias que producen (ER) evitan que su genoma se vea afectado por lasmismas? Explíquelo de forma clara y concisa.
El DNA extraño se rompe por la acción de las ER mientras que el genoma bacteriano se protege mediante la metilación, una vez metilados ya no sonreconocidos por las ER.
3. ¿Cuáles son los tipos de ER conocidas? Describa sus principales características.
Los tipos son el I y el III:
* Tienen actividad de restricción (cortan) y actividad demodificación (metilan)
* Cortan a distancia de la secuencia de reconocimiento. Las tipos I cortan lejos de la secuencia de reconocimiento, ya sea rio arriba o rio abajo. Las tipos III cortan de 5 a 8bases antes o después de la secuencia de reconocimiento.
* Necesitan ATP para moverse a través de la molécula de DNA, desde el lugar de reconocimiento hasta el sitio donde van a cortar.
TipoII:
* Solo tienen actividad de restricción.
* Cortan de manera consistente y predecible entre la secuencia que reconoce.
* Solo requieren Mg como cofactor.
* No requieren gasto de ATP.4. ¿Qué tipos de extremos pueden generarse en el DNA sustrato después de ser tratado con ER?
Pueden generarse extremos cohesivos o romos: la cola de la cadena sencilla del extremo de cada unode los fragmentos puede articular sus bases con cualquier extremo de otro fragmento generado por la misma ER causando que los extremos se unan a otros por puentes de hidrogeno.



5. Un ADN,cuya secuencia se indica, se digiere con la ER BamHI. Describa cuales serán los fragmentos producidos y preséntelos como ADN de doble cadena.
 
 ATGCGAATTCCCGCCAGGTTATGGATCCCATG
Fragmento 1:...
tracking img