Enzimas

Solo disponible en BuenasTareas
  • Páginas : 3 (655 palabras )
  • Descarga(s) : 0
  • Publicado : 19 de septiembre de 2010
Leer documento completo
Vista previa del texto
TALLER DE ENZIMAS DE RESTRICCION Y VECTORES DE CLONACION

FACULTAD DE MEDICINA

1. a. ¿Qué son, de dónde se obtienen y para qué sirven las enzimas (mejor llamadas endonucleasas) de restricción?b. ¿Cómo hacen las bacterias que producen Enzimas de Restriccion para evitar que su genoma se vea afectada por las mismas?

c. ¿Qué tipos de especificidad presentan?

d. ¿Quétipos de extremos pueden generar en el ADN sustrato?

2. Un DNA, cuya secuencia se indica, se digiere con la enzima de restricción BamHI.

ATGCGAATTCCCGCCAGGTTATGGATCCCATG

Describe cuáles seránlos fragmentos producidos (escribe en las casillas la secuencia de cada hebra)

Fragmento 1:
1ª HEBRA 5’ ------3’
2ª HEBRA 3’--------5’

Fragmento 2

1ª HEBRA 5’ ------3’
2ª HEBRA 3’--------53. Imagina que has digerido este ADN con estas dos enzimas de restricción por separado y con ambas al mismo tiempo. Realiza el análisis de los productos de digestión tras una corrida de electroforesisy tinción del gel con bromuro de etidio. En el esquema del gel mostrado a continuación (a la izquierda), indica en cada carril las bandas que esperas obtener para cada muestra.

Mapa EcoRI

MapaBamHI

Gel de electroforesis teñido

4. Estudie detenidamente la siguiente secuencia y conteste las preguntas que siguen.

Si se hace un diagrama de un segmento del DNA sin las azucares y losfosfatos, la secuencia de las bases sería:

Leer hacia la derecha ACTCCGTAGAATTC

TGAGGCATCTTAAG Leer hacia la izquierda

Compare las bases de la hebra con polaridad 5`-3`y 3`- 5`. Identifique si hay secuencias palindrómicas.
En caso de haber secuencias palindrómicas, Qué Enzima(s) podría (n) cortar y que tipo de cortes se
Generarían (buscar en internet el listadode enzimas de restricción que le puedan ayudar a contestar la anterior pregunta)

5. El siguiente diagrama representa el DNA geonómico del bacteriófago Lambda, señalando con las flechas dónde la...
tracking img