Pcr examples

Solo disponible en BuenasTareas
  • Páginas : 4 (900 palabras )
  • Descarga(s) : 0
  • Publicado : 8 de noviembre de 2011
Leer documento completo
Vista previa del texto
Grupo 1
Ingeniería Genética

Ejercicio 1:
Sea la siguiente secuencia de un gen (414 pb)
ATGAGCTGTATCTAGCCTGCGTTTTCTTCGCGGTTCAGCACCTTGCCGAGCAGGTCGACGCTGGGCGCGGTATTTTTGGCCGGTTCAATTTCAGGATCCACTCATCAGACCCGGGCCTCC

TCGAATATGCTAGCCACCACCAGGGGTGGGTTTAAAGGACTTTCGGGACCCATGGACATT

ATGGATGGGACCTGATGGTGAATGGAGGATGGTACCGGGGTCGAAGCTTAACGAATCTAGAGGTTGTGCTTTGATTTACCATACAACGAATTCTACAAACACCAGCGGGACCTGCAGTGC

GTTCAGTTTGCCGATCACGCCATTTTCCATCAGCGCCGGTTTGGCGCGCAACTGGGCGAT

CATCAGGTCCGGTTTTTTGGCCAGAATACTTTCCGCTTCTGTGGAACGATCTAG

Mediante una búsqueda de sitios de restricción en la secuenciase obtuvo las tablas siguientes:
Enzimas que no cortan la secuencia :
Enzyme | Specificity |
 AflII  | CTTAAG |
 BglII  | AGATCT |
 BspEI  | TCCGGA |
 BspHI  | TCATGA |
 ClaI  | ATCGAT | EciI  | GGCGGA(N)9NN |
 MreI  | CGCCGGCG |
 NaeI  | GCCGGC |
 NarI  | GGCGCC |
 NciI  | CCSGG |
 PacI  | TTAATTAA |
 PaeR7I  | CTCGAG |
 RsaI  | GTAC |
 SacI  | GAGCTC |
 SphI  |GCATGC |

Enzimas que cortan una vez la secuencia:

Enzyme | Specificity | Sites &
flanks | Cut positions
(blunt - 5' ext. - 3' ext.) |
 BamHI  | GGATCC | list | 94/98 |
 EcoRI  |GAATTC | list | 268/272 |
 HindIII  | AAGCTT | list | 224/228 |
 KpnI  | GGTACC | list | 215/211 |
 NcoI  | CCATGG | list | 170/174 |
 NheI  | GCTAGC | list | 129/133 |
 PstI  | CTGCAG |list | 296/292 |
 SalI  | GTCGAC | list | 54/58 |
 SmaI  | CCCGGG | list | 112 |
 StyI  | CCWWGG | list | 170/174 |
 XbaI  | TCTAGA | list | 236/240 |
 XmaI  | CCCGGG | list | 110/114 |Queremos clonar esta secuencia en el vector pBAD 24 (4.5 kb) siguiente, para realizar una análisis de expresión del gen.

XbaI : 2000

XbaI : 2000

Este vector lleva un promotor (PBAD), rioarriba de un sitio múltiple de clonación (MSC). La función de un MSC es de proveer diferentes sitios de corte por enzimas de restricción que cortan una sola vez en el plásmido, facilitando así la...
tracking img