Resultados procariotas

Solo disponible en BuenasTareas
  • Páginas : 5 (1145 palabras )
  • Descarga(s) : 0
  • Publicado : 8 de diciembre de 2011
Leer documento completo
Vista previa del texto
ASIGNATURA: Genética (Sesión Bioinformática 1)

Análisis de secuencias de DNA de procariotas

HOJA DE TRABAJO
(Rellenad el archivo y cárgalo en la carpeta de tareas de Genética (abajo derecha) o enviádnoslo por correo al acabar la práctica. El archivo tiene que tener el nombre Grupoxx_Anseq.doc donde xx debéis sustituirlo por el número del grupo que os indicará el profesor en clase). Guardaalguna versión preliminar durante la clase por si se producen problemas con el ordenador).

Miembros del grupo
| |
|Cristina Macías Gallardo |
||
|Clara Fos Vivó |
| |
|Olga Villarroya Campos|

Análisis de una secuencia bacteriana de DNA
1. Abre el archivo bacteria.seq
2. Utilizando la función geometría presenta la secuencia como cadena única y copia aquí los 100 primeros nucleótidos (después vuelve a la presentación original):5’-AGAGATTACGTCTGGTTGCAAGAGATCATAACAGGGGAAATTGATTGAAAATAAATATAT

CGCCAGCAGCACATGAACAAGTTTCGGAATGTGATCAATT-3’

3. Utilizando la función orientación haz el cambio reverse & complement (inversa y complementaria) y copia aquí los 50 primeros pares de nucleótidos de la cadena 5’-3’. Vuelve a la presentación original (reverse & complement), copia los 50 últimos pares de nucleótidos de la cadena complementaria y comprueba que secorresponden (fíjate que el programa reconoce la dirección 5’-3’ de las dos cadenas, y por tanto, siempre que copias y pegas un segmento empieza por el nucleótido en 5’ independientemente que tu lo veas a la derecha o a la izquierda):

3’-TCTCTAATGCAGACCAACGTTCTCTAGTATTGTCCCCTTTAACTAACTTT-5’
5’-AGAGATTACGTCTGGTTGCAAGAGATCATAACAGGGGAAATTGATTGAAA-3’

4. Tabla de aminoácidos. Abre la tabla deaminoácidos y copia el código de una y tres letras correspondiente a los siguientes aminoácido:

|Alanina |Glicina |Histidina |Leucina |Metionina |
|Ala A |Gly G |His H |Leu L |Met M |
|Prolina |Stop Ocre|Treonina |Valina |Cualquier aa. |
|Pro P |Och # |Thr T |Val V |Cys C |

5. Composición. Con esta función calcula la composición nucleotídica del fragmento de 400 pb comprendido entre las bases 601 y 1000.

|nucleótido |Nº bases|Porcentaje |
|Adenina |80 | 21.05% |
|Timina |86 |22.63% |
|Citosina |98 |25.79% |
|Guanina |116 |30.53% |

6. Análisis de pautas de lectura abiertas.

a. Con la herramienta Open Reading Frame Analysis haz que busque entoda la secuencia pautas de lectura abiertas (ORFs) con un mínimo de 40 aminoácidos.
¿Cuántas ha encontrado el programa?

El programa ha encontrado 27 pautas de lectura abiertas con un mínimo de 40 Aa.

Ordénalas por tamaño en formato descendente. Copia y pega aquí las características que tienen las cuatro de mayor tamaño. Indica sus coordenadas (nucleótido inicial y final), longitud...
tracking img