Taller de biologia molecular

Solo disponible en BuenasTareas
  • Páginas : 5 (1239 palabras )
  • Descarga(s) : 0
  • Publicado : 1 de marzo de 2012
Leer documento completo
Vista previa del texto
TALLER REPLICACION, PCR Y SECUENCIAMIENTO

1. Cual de estos modelos se reconoce como la replicación del ADN en los humanos. Explique en que consiste el modelo que escoge.








2. Relacione las definiciones de la columna de la derecha con las palabras de la izquierda

A. Topoisomera Iniciador o complejo de reconocimiento delorigen de replicación en eucariotas


B.Ligasa Rompe los puentes de hidrógeno
que unen las bases nitrogenadas


C.ORC Actuar sobre el ADN, enredándolo para
permitir que se almacene de manera máscompacta o desenredándolo para
facilitar la replicación del mismo.


D. Helicasa Pequeña molécula de RNA (aproximadamente
5 nucleótidos), complementaria a una
de las hebras delDNA molde.


E. RNA cebador Catalizar la unión entre dos moléculas de
gran tamaño, dando lugar a un nuevo enlace
químico




3. El siguiente esquema corresponde a la replicación de una molécula de ADN, en el que las flechas indican la dirección de replicación de lasnuevas cadenas.


Indique lo que significa las letras A,B,C Y E

A.
B.
C.
E.

4. Del punto anterior explique porqué es necesaria la síntesis de los fragmentos, señalados en el esquema con la letra C, e indique los pasos necesarios para que se unan dichos fragmentos haciendo referencia al nombre y actividad de las enzimas implicadas en este proceso.






5. Cuáles de los siguientesson principios de la PCR
A. Permite la síntesis exponencial de una región determinada de ADN
B. Son altamente específicas
C. Es conservativa
D. La A y B
E. La A y la C
F. La A,B y C


6. Porque es ideal utilizar la enzima taq polimerasa proveniente de la bacteria Termófilos acuáticos


7. Ubicar en el esquema lo siguiente:

A. Sitio de anillamiento corriente abajo
B. Extensión porel iniciador
C. Iniciador reverso, antisentido
D. Iniciadordirecto,sentido
E. Extensión por el iniciador
F. Sitio de anillamiento corriente arriba


5´ ATTGGGACCAGCGCTTCTA-OH´33´-OH-TAACCCTGGTCGCGAAGAT-P-5´

5´-P-ACCTGAACCGCGTTACCCGA-OH´3
3´-OH-TGGACTTGGCGCAATGGGCT


8. Cuál de las siguientes características no se debe tener en cuenta a la hora de diseñar los iniciadores o cebadores (primers)
A. El sitio de anillamiento sobre la secuencia blanco debe ser conocida
B. La diferencia de las temperaturas de anillamiento de los primers (sentido y antisentido) puede ser mayor de 10 grados.
C.se diseñan con una longitud de 18 a 22 nucleótidos
D. Que contenga un 30% de GC
E. Que no presenten formación de estructuras secundarias (bucles o horquillas)
F. La A,C y E son verdaderas.



9. Cuál de los siguientes primers tiene las mejores características para amplificar la secuencia de ADN. El que escoja ubíquelo en la secuencia y determine el tamaño del fragmento que se forma alutilizar estos primers.

GGAGAAAATATAATTCCTATAATATCATACATCTTGCTCTTTCAGCTGCCAATTAAGAGGTAAGAGGTTGAAAAGTGTCTAAAGGTGGAGGTGGAGGGGAAGCAGCTTGTTCTTCTCTCTGGAGCCATTACCTGAGCTGTGAGATTCTCTTTTATAACCACTGAGTATCCAAGGTTTTCAAGTAGATCTCGCATCCCCAAAAGGTCAAGTTCAGAACCATTTCGATTATGAAGATAGTTGAATTCTTTGTTGCGGATGTTGAGGCCAGGCATGTTCGCCTCTCTTTCTCCATCACTGGATATATCTGCAATTAATACACACAGAATGACTTTCCCCAGGACTTTTCTCTT TTGCCTGCAA


A...
tracking img