Tecnologia del adn

Solo disponible en BuenasTareas
  • Páginas : 3 (690 palabras )
  • Descarga(s) : 0
  • Publicado : 1 de mayo de 2011
Leer documento completo
Vista previa del texto
Tecnología Del DNA Recombinante
DNA Recombinante: Una molécula de DNA formada por la unión de segmentos de DNA de distintos orígenes. Los DNAs recombinantes son utilizados en el clonamiento degenes, en la modificación genética de organismos y como herramienta general en biología molecular.

Algunas técnicas utilizadas: • Corte de DNA en secuencias específicas por endonucleasas de restricción(enzimas de restricción) • Hibridización o Hibridación de ácidos nucleicos: permite encontrar una secuencia específica de DNA o RNA sobre la base de la complementariedad de bases • Clonamiento deDNA: una molécula de DNA puede ser copiada para generar muchas copias idénticas de ella • Amplificación de segmentos de DNA por la reacción en cadena de la polimerasa o PCR.

Endonucleasas o Enzimasde Restricción

Permiten generar un mapa o patrón de restricción

Análisis de DNA Digerido con Enzimas de Restricción

DESNATURACIÓN Y RENATURACIÓN (HIBRIDACIÓN DEL DNA)

calor pH elevadofrio Baja del pH

dsDNA

Desnaturación a cadenas simples

Renaturación a cadenas dobles

calor pH elevado

frio Baja del pH

SONDA

DNA unido a la membrana

sonda

3’ ACCAGAGCCTAGC5’ 5’ ACTGCTCGATGCTCTCGGATCGCTCTGATTCG 3’
Nitrocelulosa

Southern blot

Cervical Intraepithelial Neoplasia II & HPV
20 X 40 X

RNAmtnc sentido II 20 X 40 X

RNAmtnc sentido II

RNAmtncsentido I

RNAmtnc sentido I

Reacción en Cadena de la Polimerasa (PCR) (polymerase chain reaction)
Hebras de DNA complementarias separadas por calor
El primer ciclo de la reacción en cadenade la polimerasa (PCR) para amplificar secuencias específicas de DNA. El DNA aislado de células es calentado para separar sus hebras complementarias. Estas hebras son hibridizadas a dos fragmentos deDNA de hebra simple (oligonucleótidos), que han sido sintetizados químicamente. Estos dos oligonucleótidos sirven como partidores específicos para la síntesis de DNA por la DNA polimerasa, la cual...
tracking img