• Ensayo
    , durante la interfase ocurren varios eventos como la duplicación de los cromosomas, la célula está gastando mucha energía. 7. 8. 9. 10. 11. 12. Guía didáctica para el profesor 2 Unidad 1 13. El daño a los nervios suele ser permanente. ¿Por qué crees que es difícil...
    29058 Palabras 117 Páginas
  • Búsqueda de marcadores moleculares en tomate
    LA4246 7 LA4266 13 LA3345 9 LA4270 5 LA4279 4 LA3892 5 LA4282 11 Las semillas de las distintas ILs empleadas fueron proporcionadas inicialmente por el TGRC, si bien algunas de las descendencias ensayadas proceden de reproducciones realizadas posteriormente...
    19554 Palabras 79 Páginas
  • Practicas de campo
    equipo Ind. F1 II com bina cio nes re peti cio nes AB AB AB AB Ab Ab Ab Ab aB aB aB aB ab ab ab ab AB 1 Ab 2 aB 3 ab 4 AB 5 Ab 6 aB 7 ab 8 AB 9 Ab 10 aB 11 ab 12 AB 13 Ab 14 aB 15...
    14167 Palabras 57 Páginas
  • Cariotipos
    núcleos femeninos Bibliografía Mackean, D. G. , 1996. GCSE Biology. Ed. J. Murray Pag 10 Web sites http://es.wikipedia.org/wiki/Mutaci%C3%B3n consulta 22/08/09 6.52 p.m. ----------------------- Cromosomas Sexuales A G F E D C B 1 7 6 13 14 15 16 17 18 19 20 22 21 2 3 4 5 8 9 10 11 12 X Y...
    2801 Palabras 12 Páginas
  • Genetica
    . CUESTIONARIO 1) ¿Qué características se toman en cuenta para agrupar a los cromosomas en pares homólogos? 2) ¿Qué técnicas facilitan la identificación de los cromosomas? 3) Investigue el número cromosómico de alguna especie vegetal y mencione alguna anomalía causada por falta o exceso en su número...
    14839 Palabras 60 Páginas
  • Ingeniera Civil
    nuestra naturaleza orgánica, diferentes estímulos pueden determinar en diferentes especies lo que se llegará a realizar a partir de las posibilidades que existen” 7 . 7 En 1905, año en que Stevens y Wilson presentaron sus datos sobre la determinación cromosómica del sexo, Morgan publicó dos...
    15955 Palabras 64 Páginas
  • hibridos
    cambian a través del Capítulo 1 5 tiempo, propuso la existencia de gémulas o fragmentos de las diferentes partes de nuestro cuerpo que al unirlas daban origen a nuevas especies. “August Weissmann (1834-1914) se opuso a la teoría de la pangénesis pero en su lugar postuló “la teoría del...
    14129 Palabras 57 Páginas
  • Comparacion y alteracion de gentipos
    dice que provenimos de él. Después de esta interrogante se averiguo en Internet y se demostró que tienen la misma cantidad de cromosomas. 5.- ¿Existe una relación entre el grado de complejidad de la especie y el numero de cromosomas? R.-No, según la tabla enseñada el algodón tiene 26 pares de...
    1301 Palabras 6 Páginas
  • guia de biologia
    equipo. Anoten y súmenlos. Ganará el que tenga mayor puntaje. PREGUNTAS 1. ¿Por qué se ha hecho diferentes números de cartas para los aminoácidos? ¿Existe alguna sustentación biológica? 2. ¿A partir de la siguiente secuencia de DNA: TACGGTAACTTTTATCGCTGCATG, determine'. • La cadena de mRNA (en...
    9748 Palabras 39 Páginas
  • Bachiller
    . Traducción del ARN 5. Síntesis de ADN 6. Síntesis de proteínas. 7. Alteración en la síntesis de ADN 8. Mutaciones Inducción de mutaciones 9. Importancia 10. Prevención 11. Mutaciones: génicas, cromosómicas y genómicas. OBJETIVO: Analizar las funciones básicas de las células como diferentes...
    4537 Palabras 19 Páginas
  • Cromosomas sexuales
    idiocromosomas y el cromosoma accesorio debían estar relacionados de alguna manera con la determinación del sexo, ya que las especies con cromosoma accesorio producían dos tipos de espermatozoides; en Anasa tristis, el hemíptero que investigó, unos tenían 10 y otros 11 cromosomas. Pero corregía la...
    14543 Palabras 59 Páginas
  • Genética molecular
    del cruce de plantas de la F1 surgen tres fenotipos diferentes: b) Alelismo múltiple: Muchos genes tienen más de dos alelos (si bien un individuo diploide solo puede tener dos alelos por cada gen). Los alelos múltiples se originan de diferentes mutaciones sobre un mismo gen. El sistema ABO para...
    9811 Palabras 40 Páginas
  • preguntas de selectividad
    significado biológico. Explique las diferentes fases de la mitosis. 7) Defina los conceptos de: replicación, transcripción y traducción. ¿En qué parte de la célula procariota y eucariota tienen lugar estas funciones celulares?. Describa cómo se lleva a cabo la transcripción. 8) (Raz.) Las células...
    7530 Palabras 31 Páginas
  • Practicas de Laboratorio
    , (cromosomas 1, 2 y 3), meta y submetacéntricos • Grupo B, (cromosomas 4 y 5), submetacéntricos Cromosomas medianos • Grupo C, (cromosomas 7, 8, 9, 10, 11, 12 y además los cromosomas submetacéntricos • Grupo D, (cromosomas 13, 14 y 15) acrocéntricos Cromosomas pequeños • Grupo E, (cromosomas...
    10176 Palabras 41 Páginas
  • Mamografias
    dos cromosomas separados. Ocurre lo mismo para dos especies más lejanas como el gorila y el orangután.[3] [4] * La presencia del vestigio de estructura de centrómero. Normalmente un cromosoma tienen solo un centrómero, pero en el cromosoma 2 podemos ver restos de un segundo.[5] * La presencia...
    18244 Palabras 73 Páginas
  • Algoritmos geneticos
    Walsh [13] y “folding protein” [14]. 23 Referencias [1]. [2]. [3]. [4]. [5]. [6]. [7]. [8]. [9]. [10]. [11]. [12]. [13]. [14]. Adaptation in Natural and Artificial Systems, Holland, J., Ann Harbor: University of Michican Press, 1975. On The Origin of Species by Means of Natural Selection, or The...
    6282 Palabras 26 Páginas
  • LAS CELULAS
    cromosomas 6. Defina los siguientes conceptos 1. Menstruación 2. Ovulación 3. Ciclo menstrual 4. Estrógeno 5. Testosterona 7. Establezca diferencias entre los siguientes pares de conceptos 1. Óvulo y espermatozoide 2. Haploide y diploide 3...
    14784 Palabras 60 Páginas
  • Biologia
    representa un proceso básico en algunos organismos: [pic] a) Indique la denominación del proceso representado y su localización a nivel de orgánulo. Complete los números 1, 2, 3, 4 y 5 (1,5 puntos). b) Explique el significado biológico del proceso representado en el esquema (0,5 puntos...
    24419 Palabras 98 Páginas
  • Guia De Laboratorio De Biologia
    de tuberculina. 5. Pipetas. 6. Propipetas. 7. Placas Petri 8. Tubos de ensayo 16 Guía de Practicas de Biología Celular y Molecular Universidad Ricardo Palma 9. Baguetas de vidrio 10. Gradillas 11. Colorante Wright. 12. Agua Oxigenada. 13. Papel lente. IV) PROCEDIMIENTO...
    18764 Palabras 76 Páginas
  • genetica
    HERENCIA MENDELIANA 1. En las amapolas, algunas flores tienen una mancha púrpura en la base de cada pétalo, mientras que otras no. La tabla muestra el resultado de diferentes cruzamientos entre tres plantas con flores manchadas (plantas A, B, y C) y tres plantas con flores sin manchas...
    6778 Palabras 28 Páginas