Conclusion De Acidos Nucleicos ensayos y trabajos de investigación

acidos nucleicos

BIOQUIMICA HUMANA DOCENTE LIC. MARIO DELGADO ESTUDIANTES ANDREA SANTA ANA 11 DE AGOSTO 2012 INDICE INTRODUCCION Los acidos nucleicos son esenciales para las funciones que llevan a cabo todas las células de nuestro cuerpo ya que al hablar de acidos nucleicos nos estamos refiriendo al DNA y el RNA. El DNA lleva a cobo una función sumamente importante debido a que el mismo es el que almacena todo en material genético de las células y...

916  Palabras | 4  Páginas

Leer documento completo

Acidos nucleicos

Índice Introducción ………………………………………………………….. 2 Los acidos nucleicos ………………………………………………….3 Composición de los acidos nucleicos ……………………………….4 Nucleótidos de importancia biológica ……………………………….. 6 Funciones biológicas de los acidos nucleicos ……………………….9 Conclusión …………………………………………………………… 11 iNTRODUCCIÓN Todas las células contienen la información necesaria para realizar distintas reacciones químicas mediante las cuales las células crecen, obtienen energía y sintetizan sus componentes...

1711  Palabras | 7  Páginas

Leer documento completo

Acidos Nucleicos

Ácidos Nucleicos Introducción Los ácidos nucleicos son las biomoléculas portadoras de la información genética. Tienen una estructura polimérica, lineal, cuyos monómeros son los nucleótidos. El grado de polimerización puede llegar a ser altísimo, con moléculas constituidas por centenares de millones de nucleótidos en una sola estructura covalente. De la misma manera que las proteínas son polímeros lineales aperiódicos de aminoácidos, los ácidos nucleicos lo son de nucleótidos. La aperiodicidad...

539  Palabras | 3  Páginas

Leer documento completo

Acidos Nucleicos

Colegio Vocacional Monseñor Sanabria Biología Profesora: Marta Vega Tema: Ácidos Nucleicos Alumnas: Guiselle Reyes M Betsabé Campos A Tirza Delgado Fajardo Sección: 11-11 Fecha de entrega: 21/04/15 Introducción 1.- Composición de los ácidos nucleicos.   2.- Tipos de ácidos nucleicos.   3.- Ácido desoxirribonucleico (ADN)   4.-Ácido Ribonucleico (ARN).   5.- Funciones de los ácidos nucleicos. Ácidos Nucleicos Son biopolímeros, de elevado peso molecular, formados por otras subunidades...

1679  Palabras | 7  Páginas

Leer documento completo

ÁCIDOS NUCLEICOS

ÁCIDOS NUCLEICOS OBJETIVOS: OBJETIVO GENERAL: Analizar los ácidos nucleicos mediante la investigación de los mismos para conocer a profundidad su estructura e importancia en nuestro cuerpo.  OBJETIVOS ESPECÍFICOS: Reconocer e identificar los tipos de ácidos nucleicos y conocer las principales diferencias existentes entre estas moléculas. Conocer las principales funciones de los ácidos nucleicos y su importancia en organismos eucariotas y procariotas haciendo énfasis en las diferencias...

1009  Palabras | 5  Páginas

Leer documento completo

Acidos nucleicos

Primero TEMA: Ácidos Nucleicos MATERIA: Bioquímica FECHA: Lunes 8 de Noviembre de 2010 INDICE DEFINICION 3 FUNCION 3 ESTRUCTURA DE UN ACIDO NUCLEICO 4 TIPOS 5 ESTRUCTURA DE LOS NUCLEOTIDOS 5 NUCLEOSIDO 6 BASE NITROGENADA 6 AZÚCAR 7 ESTRUCTURA DEL ADN Y LOCALIZACIÓN 8 TIPOS DE ADN 8 MODELO DE WATSON Y CRICK 9 ESTRUCTURA, TIPOS Y FUNCIONES DEL RNA 10 ESTRUCTURA DEL ADN Y DEL ARN: 11 CONCLUSION 12 BIBLIOGRAFIA 12 DEFINICION Químicamente, los ácidos nucleicos son polímeros...

1664  Palabras | 7  Páginas

Leer documento completo

acidos nucleicos

ACIDOS NUCLEICOS NUCLEÓSIDOS: Formados por la unión de la base nitrogenada y el azúcar, pero carecen de fosfato. Algunos antibióticos como la puromicina producto de un hongo son nucleosidos. imagen Propiedades físico químicas de los nucleótidos Estas propiedades dependen de sus tres componentes : Carácter hidrofílico: El azúcarcomo la base nitrogenada poseen grupos polares que hacen que estos compuestos sean solubles en solventes polares. A esta propiedad contribuyen los grupos fosfatos. ...

1159  Palabras | 5  Páginas

Leer documento completo

ACIDOS NUCLEICOS

 ACIDOS NUCLEICOS Los ácidos nucleicos: estos son grandes polímeros formados por la repetición de monómeros denominados nucleótidos, unidos mediante enlaces fosfodiéster. Se forman, así, largas cadenas; algunas moléculas de ácidos nucleicos llegan a alcanzar tamaños gigantescos, con millones de nucleótidos encadenados. Los ácidos nucleicos almacenan la información genética de los organismos vivos y son los responsables de la transmisión hereditaria. Existen dos tipos básicos...

869  Palabras | 4  Páginas

Leer documento completo

Acidos Nucleicos

ACIDOS NUCLEICOS 1. INTRODUCCION: Son biopolímeros, de elevado peso molecular, formados por otras subunidades estructurales o monómeros, denominados nucleótidos. El descubrimiento de los ácidos nucleicos se debe a Meischer (1869), el cual trabajando con leucocitos y espermatozoides de salmón, obtuvo una sustancia rica en carbono, hidrógeno, oxígeno, nitrógeno y un porcentaje elevado de fósforo. A esta sustancia se le llamó en un principio nucleina, por encontrarse en el núcleo. Años más tarde...

1153  Palabras | 5  Páginas

Leer documento completo

ACIDOS NUCLEICOS

ÁCIDOS NUCLEICOS Colegio de Estudios Científicos y Tecnológicos del Estado de Hidalgo. Bioquímica Profesora: Q. Sandra López Gámez INTEGRANTES: 1.- Alfonso León Hernández 2.- Lizbeth Chávez Camargo 3.- Erick Eduardo Pérez Pérez 4.- Jafeth Erubey Estrada Hernández. 5.- Daniel Reyes Sierra 6.- Mariana Peña Solís 7.- Dayanira Neri Pérez 8.- Juan José Rosas Sánchez 9.- Jeimmie Gabriela Espino Ramírez 10.- José de Jesús Zamudio Aguilar 11.- Ariadna Dánae Callejas León 12.- Angélica Pérez Hernández...

1051  Palabras | 5  Páginas

Leer documento completo

Ácidos Nucleicos

Introducción. Los Ácidos Nucleicos, como veremos en nuestra disertación juegan un papel importante dentro de los seres vivos, debido a que estos, son los responsables de almacenar y transferir información genética y en la síntesis de proteínas. Por eso podemos decir, de que los ácidos nucleicos están presentes tanto como en la concepción del ser humano, como en el diario vivir. Friedrich Miescher, un científico Suizo, en el año 1869, pudo identificar los ácidos nucleicos. Este,  Aisló varias moléculas ricas...

890  Palabras | 4  Páginas

Leer documento completo

Acidos nucleicos

INDICE Introducción. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Pág.- 1 Desarrollo. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Págs.- 2, 3. Conclusión. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Pág.- 4 Bibliografía. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Pág.- 5 Anexo. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Pág...

707  Palabras | 3  Páginas

Leer documento completo

Acidos Nucleicos

Universidad de San Carlos de Guatemala Facultad de Ciencias Médicas Unidad Didáctica de Biología Primer año – Fase I ACIDOS NUCLEICOS INTRODUCCIÓN El ADN se denomina ácido desoxirribonucleico, es un polímero formado por dos hebras complementarias de desoxirribonucleótidos, que se unen antiparalelamente. Su función principal, es el almacenamiento de información genética en todas las células. En organismos procariotas, se encuentra en forma libre a nivel citosólico, y en eucariotas...

556  Palabras | 3  Páginas

Leer documento completo

Acidos Nucleicos

DE LOS ACIDOS NUCLEICOS INTRODUCCION. ACIDOS NUCLEICOS Los ácidos nucleicos fueron descubiertos por Friedrich Miescher en 1869. En la naturaleza existen solo dos tipos de ácidos nucleicos: el ADN (acido desoxirribonucleico) y el ARN (acido ribonucleico) y están presentes en todas las células. Su función biológica no quedo plenamente confirmada hasta que Avery y sus colaboradores demostraron en 1944 que el ADN era una molécula portadora de la información genética. Los ácidos nucleicos tienen...

548  Palabras | 3  Páginas

Leer documento completo

acidos nucleicos

OBJETIVOS 1. Utilizar técnicas de hidrolisis de ácidos nucleicos en tejido vegetal y animal 2. Detectar componentes específicos de los ácidos nucleicos mediante diferentes ensayos químicos MARCO TEORICO En la naturaleza existen solo dos tipos de ácidos nucleicos: El ADN (ácido desoxirribonucleico) y el ARN (ácido ribonucleico) y están presentes en todas las células. Los ácidos nucleicos tienen al menos dos funciones: trasmitir las características...

1746  Palabras | 7  Páginas

Leer documento completo

Ácidos Nucleicos

Cecilia Punto Fijo, Edo. Falcón Ácidos Nucleicos Ácidos Nucleicos 3er año, sección B Realizado por: Marlon Solórzano #33 Introducción Los ácidos nucleicos son macromoléculas, polímeros formados por la repetición de monómeros llamados nucleótidos, unidos mediante enlaces fosfodiéster. Se forman, así, largas cadenas o polinucleótidos, lo que hace que algunas de estas moléculas lleguen a alcanzar tamaños gigantes (de millones de nucleótidos largos). Los ácidos nucleicos tienen la función de almacenar...

1242  Palabras | 5  Páginas

Leer documento completo

Acidos nucleicos

Instituto Maracaibo II Biología. ACIDOS NUCLEICOS Integrante: Rosario Flores C.I: 13.070.271 Semestre 11 Caracas, mayo del 2013 INTRODUCCION A continuación se presenta una investigación acerca de unas moléculas muy complejas e importantes en la biológica llamadas ácidos nucleicos, las cuales están presentes en todos los organismos en forma de ácido desoxirribonucleico (ADN) y ribonucleico (ARN). Sin duda alguna, los ácidos nucleicos son las sustancias fundamentales de los...

963  Palabras | 4  Páginas

Leer documento completo

Ácidos nucléicos

| | INTRODUCCIÓN Los ácidos nucleicos son las biomoléculas portadoras de la información genética. Tienen una estructura polimérica, lineal, cuyos monómeros son los nucleótidos. El grado de polimerización puede llegar a ser altísimo, con moléculas constituídas por centenares de millones de nucleótidos en una sola estructura covalente. De la misma manera que las proteínas son polímeros lineales aperiódicos de aminoácidos, los ácidos nucleicos lo son de nucleótidos. La aperiodicidad...

1719  Palabras | 7  Páginas

Leer documento completo

acidos nucleicos

Introducción Los ácidos nucleicos son un polímero natural, ya sea, ADN o ARN, donde su monómero es el nucleótido, a su vez, éste está constituido por un azúcar de cinco carbonos (desoxirribosa en ADN y ribosa en el ARN), un grupo fosfato y una base nitrogenada. El ADN y el ARN comparten tres de estas bases que son: adenina, citosina, guanina, timina y uracilo siendo la timina exclusiva del ADN y el uracilo exclusivo del ARN, estas se unen entre sí por puentes de hidrogeno, la adenina con la timina...

502  Palabras | 3  Páginas

Leer documento completo

acidos nucleicos

ACIDOS NUCLEICOS Historia Descubrimiento de los Ácidos Nucleicos. En 1871, el Bioquímico suizo Friedrich Miescher aisló una sustancia de los núcleos de los glóbulos blancos y la llamo “nucleina”, encontró que esta contenía importantes cantidades de fosforo y noto que su característica principal era su naturaleza “acida” Trabajos que dilucidaron la naturaleza del material hereditario Experimentos de Griffith En 1928, un microbiólogo británico llamado Frederick Griffith, estudio la posibilidad...

1593  Palabras | 7  Páginas

Leer documento completo

Acidos nucleicos

Prueba de Caracterización de Ácidos Nucleicos Escuela de Química. Departamento de Bioquímica (QM382) Resumen: Se utilizaron muestras de ADN y ARN donde se le aplicaron pruebas de caracterización como la difenilamina la cual se realizó y se obtuvo un color azul verdoso, sulfato de amonio con un precipitado ya que está es una solución salina y la prueba de orcinol en esta se determinaba la presencia de pentosas y su color es verde brillante. Palabras claves: polianión, polivalentes, catión...

1083  Palabras | 5  Páginas

Leer documento completo

Acido Nucleico

dio origen a la “genética molecular”. La primera pregunta fue simple: ¿de qué están formados los cromosomas? Los análisis químicos demostraron que los cromosomas de los organismos superiores están formados por proteínas y en cantidades menores, por acido desoxirribonucleico. Así, los científicos que creían que la clave para comprender la herencia tenía que encontrarse en la química de los genes, se enfrentaron con una segunda y más difícil pregunta: ¿los genes están formados por proteínas o por ADN...

1692  Palabras | 7  Páginas

Leer documento completo

ACIDOS NUCLEICOS

INTRODUCCIÓN Los ácidos nucleicos son macromoléculas complejas de suma importancia biológica, ya que todos los organismos vivos contienen ácidos nucleicos en forma de ácido desoxirribonucleico (ADN) y ribonucleico (ARN). Sin embargo; algunos virus sólo contienen ARN, mientras que otros sólo poseen ADN. Se les denomina así porque fueron aislados por primera vez del núcleo de células vivas. No obstante, ciertos ácidos nucleicos no se encuentran en el núcleo de la célula, sino en el citoplasma celular...

1412  Palabras | 6  Páginas

Leer documento completo

Ácidos nucleicos

A lo largo de los años los ácidos nucleicos han sido objeto de estudio de muchos científicos y a través de numerosos experimentos se ha ido conociendo más sobre su estructura y funciones. Los ácidos nucleicos son macromoléculas complejas de suma importancia a nivel biológico ya que se encuentran en todas las células vivas, además de en los virus (Nason Albín 1965). Son las sustancias responsables de la herencia biológica: las moléculas que rigen la actividad de la materia viva, tanto en el espacio...

860  Palabras | 4  Páginas

Leer documento completo

Acidos nucleicos

Tipos de ácidos nucleicos Existen dos tipos de ácidos nucleicos: ADN (ácido desoxirribonucleico) y ARN (ácido ribonucleico), que se diferencian: * por el glúcido (pentosa) que contienen: la desoxirribosa en el ADN y la ribosa en el ARN; * por las bases nitrogenadas que contienen: adenina, guanina, citosina y timina, en el ADN; adenina, guanina, citosina y uracilo, en el ARN; * en los organismos eucariotas, la estructura del ADN es de doble cadena, mientras que la estructura del ARN...

1743  Palabras | 7  Páginas

Leer documento completo

acidos nucleicos

4: MACROMOLÉCULAS ORGÁNICAS: ÁCIDOS NUCLEICOS. Bryan Barrera Isaac Bolagay Andreeé Flores I. Introducción Para obtener la mayor parte de los grandes adelantos científicos y especialmente sobre la estructura del DNA y su funcionamiento, se necesitaron de avances graduales de varios científicos que a través del tiempo fueron logrando descubrimientos importantes sobre ésta molécula. Hace no más de 60 años, se desconocía que el ácido desoxirribonucleico o DNA, es la...

1430  Palabras | 6  Páginas

Leer documento completo

ACIDOS NUCLEICOS

DE LOS ACIDOS NUCLEICOS Introduccion El descubrimiento de que la información genética esta codificada a lo largo de una molecula polimerica compuesta. Esta molecula polimerica, el DNA, es la base química de la herencia y esta organizada en genes, unidades fundamentales de la información genética. Los genes controlan las síntesis de varios tipos de RNA, que en su mayor parte están involucrados en la síntesis de proteínas. El conocimiento de la estructura y función de los acidos nucleicos, es esencial...

1270  Palabras | 6  Páginas

Leer documento completo

acidos nucleicos

ÁCIDOS NUCLEICOS PRESENTADO POR: -ANDREA CAROLINA ÁLVAREZ PÉREZ -ANDREA VANESSA MEDINA SUÁREZ -ANDREINA MEDINA SUÁREZ -ANA MARÍA REYES PÉREZ PRESENTADO A: Mg. CARLOS VERGARA RIVERA ÁREA: BIOQUÍMICA GRADO: 11º1 MATINAL INSTITUCIÓN EDUCATIVA LICEO CARMELO PERCY VERGARA COROZAL-SUCRE 2015 1. Elaborar un mentefacto sobre el ADN y su importancia en la vida de los organismos. ...

1095  Palabras | 5  Páginas

Leer documento completo

Acidos nucleicos

Los ácidos nucleicos son macromoléculas, polímeros formados por la repetición de monómeros llamados nucleótidos, unidos mediante enlaces fosfodiéster. Se forman, así, largas cadenas o polinucleótidos, lo que hace que algunas de estas moléculas lleguen a alcanzar tamaños gigantes (de millones de nucleótidos de largo). El descubrimiento de los ácidos nucleicos se debe a Miescher que en la década de 1860 aisló de los núcleos de las células una sustancia ácida a la que llamó nucleína, nombre que posteriormente...

715  Palabras | 3  Páginas

Leer documento completo

Acidos Nucleicos

ACIDOS NUCLEICOS HISTORIA El descubrimiento de los ácidos nucleícos se debe a Meischer (1869), el cual trabajando con leucocitos y espermatozoides de salmón, obtuvo una sustancia rica en carbono, hidrógeno, oxígeno, nitrógeno y un porcentaje elevado de fósforo. A esta sustancia se le llamó en un principio nucleína, por encontrarse en el núcleo. Años más tarde, se fragmentó esta nucleína, y se separó un componente proteico y...

1698  Palabras | 7  Páginas

Leer documento completo

Ácido Nucleico

Ácido nucleico 339505220657000Los ácidos nucleicos son grandes polímeros formados por la repetición de monómeros denominados nucleótidos, unidos mediante enlaces fosfodiéster. Se forman, así, largas cadenas; algunas moléculas de ácidos nucleicos llegan a alcanzar tamaños gigantescos, con millones de nucleótidos encadenados. Los ácidos nucleicos almacenan la información genética de los organismos vivos y son los responsables de la transmisión hereditaria. Existen dos tipos básicos, el ADN y el ARN...

1528  Palabras | 7  Páginas

Leer documento completo

acidos nucleicos

00DESCUBRIMIENTO DEL ACIDO NUCLEICO xD DESCUBRIMIENTO DEL ACIDO NUCLEICO xD El descubrimiento de los ácidos nucleicos se debe a Friedrich Miescher (1869), el cual trabajando con leucocitos y espermatozoides de salmón, obtuvo una sustancia rica en carbono, hidrógeno, oxígeno, nitrógeno y un porcentaje elevado de fósforo. A esta sustancia se le llamó en un principio nucleína, por encontrarse en el núcleo. Años más tarde, se fragmentó esta nucleína, y se separó un componente proteico y un grupo...

1513  Palabras | 7  Páginas

Leer documento completo

ÁCIDOS NUCLEICOS

 “ÁCIDOS NUCLEICOS” URBANO LEÓN CASTAÑEDA BIOLOGÍA CELULAR JAIME EDUARDO ARIZA CONTRERAS ITAT (INSTITUTO DEL ALTIPLANO DE TLAXCALA) 1 “B” AGRONOMÌA INDICE 1.1 INTRODUCCIÓN… 1.2 TIPOS DE ÁCIDOS NUCLEICOS… 1.3 BASES NITROGENADAS… 1.4 CARACTERÍSTICAS DEL ADN… 1.5 FUNCIONES DEL ADN 1.6 ESTRUCTURAS DEL ADN… 1.7 CARACTERÍSTICAS DEL ARN… 1.8 ÁCIDOS NUCLEICOS ARTIFICIALES O RIBONUCLEICOS… 1.9 ALIMENTOS RICOS EN ÁCIDOS NUCLEICOS… INTRODUCCIÓN Los ácidos nucleicos son compuestos orgánicos de elevado...

1529  Palabras | 7  Páginas

Leer documento completo

ACIDOS NUCLEICOS

ACIDOS NUCLEICOS 1.-¿QUÉ SON? Los ácidos nucleicos son grandes polímeros formados por la repetición de monómeros denominados nucleótidos, unidos mediante enlaces fosfodiéster. Se forman, así, largas cadenas; algunas moléculas de ácidos nucleicos llegan a alcanzar tamaños gigantescos, con millones de nucleótidos encadenados. Los ácidos nucleicos almacenan la información genética de los organismos vivos y son los responsables de la transmisión hereditaria. Existen dos tipos básicos, el ADN y el ARN...

797  Palabras | 4  Páginas

Leer documento completo

acidos nucleicos

Los ácidos nucléicos son grandes polímeros formados por la repetición de monómeros denominados nucleótidos, unidos mediante enlaces fosfodiéster. Se forman, así, largas cadenas; algunas moléculas de ácidos nucléicos llegan a alcanzar tamaños gigantescos, con millones de nucleótidos encadenados. Los ácidos nucléicos almacenan la información genética de los organismos vivos y son los responsables de la transmisión hereditaria. Existen dos tipos básicos, el ADN y el ARN. El descubrimiento de los...

1455  Palabras | 6  Páginas

Leer documento completo

ácidos nucleicos

Ácidos nucleicos Son compuestos orgánicos de elevado peso molecular, formados por carbono, hidrógeno, oxígeno, nitrógeno y fósforo. Cumplen la importante función de sintetizar las proteínas específicas de las células y de almacenar, duplicar y transmitir los caracteres hereditarios. Los ácidos nucleicos, representados por el ADN (ácido desoxirribonucleico) y por el ARN (ácido ribonucleico), son macromoléculas formadas por la unión de moléculas más pequeñas llamadas nucleótidos. Dentro de sus...

907  Palabras | 4  Páginas

Leer documento completo

acidos nucleicos

inserciones y/o deleciones). a) 5’ AUGCGUCUGUGGUCUGAAUUA 3’ b) 5’ AUGCGUCAUUGGUCUGAAUUA 3’ c) 5’ AAUGCGUCUUUGGUCUGAAUUA 3’ d) 5’ AUGCGUCCUUUGGUCUGAAUUA 3’ e) 5’ AUGCGUCUUUGGUCUGAAUA 3’ Indiquen el tipo de cambio producido a nivel ácido nucleico y determinen las consecuencias que originan a nivel proteico. ¿En qué procesos del Dogma Central pueden ocurrir estos cambios? 22) En las células eucarióticas existe una gran cantidad de ADN en exceso, o por lo menos, ADN cuyas funciones son...

1435  Palabras | 6  Páginas

Leer documento completo

Acidos Nucleicos

ACIDOS NUCLEICOS NOTA: lo que está en Negrita es lo que esta en la dispositiva, el resto de información fue copiada y pegada de internet asi que cada un@ resume su parte como quiera. Diapositiva 1: Liliana Presentación Diapositiva 2: Liliana Los Ácidos Nucleicos son las biomoléculas portadoras de la información genética. Son biopolímeros, de elevado peso molecular, formados por otras subunidades estructurales o monómeros, denominados Nucleótidos. Desde el punto de vista químico, los ácidos...

1386  Palabras | 6  Páginas

Leer documento completo

Acidos Nucleicos

ADN Y ARN ACIDOS ACIDOS NUCLEICOS FUNDACIÓN UNIVERSITARIA MARIA CANO SECCIÓN MEDELLÍN ANDRÉS CASTAÑO CASTAÑO CODIGO 11150079 DIANA MARIA GONZALEZ MOSALVE CODIGO 11150119 FACULTAD DE CIENCIAS DE LA SALUD PSICOLOGÍA BIOQUIMICA 2011 RECONOCIMIENTO DEL TEXTO * Tesis Los ácidos nucleícos están muy relacionados con las biomoleculas de las células elementales en la vida de todo ser viviente, teniendo en cuenta que la célula es una unidad básica de la vida y que es capaz...

892  Palabras | 4  Páginas

Leer documento completo

Acidos Nucleicos

INTRODUCCIÓN En el presente informe se desarrollará una serie de actividades correspondientes a la unidad 2 del módulo en relación a los temas de ácidos nucleicos. Se elaborará un diagrama con la metodología de extracción de ADN y los factores causantes de la denaturación del mismo; se tratará de explicar cómo la molécula de ATP tiene aplicación en el campo de la limpieza y desinfección. Esperamos sea de su agrado. OBJETIVOS * Reconocer la importancia de la extracción de ADN para su...

1395  Palabras | 6  Páginas

Leer documento completo

Ácidos Nucleicos

ÁCIDOS NUCLEICOS Los ácidos nucleicos son macromoléculas, polímeros formados por la repetición de monómeros llamados nucleótidos, unidos mediante enlaces fosfodiéster. Se forman, así, largas cadenas o polinucleótidos, lo que hace que algunas de estas moléculas lleguen a alcanzar tamaños gigantes (de millones de nucleótidos de largo). Existen dos tipos de ácidos nucleicos: ADN ARN Glúcido (pentosa): Desoxirribosa Glúcido (pentosa): ribosa Base nitrogenada: Adenina, Guanina, citosina y timina ...

543  Palabras | 3  Páginas

Leer documento completo

Acidos nucleicos

 Los ácidos nucleicos son grandes polímeros formados por la repetición de monómeros denominados nucleótidos, unidos mediante enlaces fosfodiéster. Se forman, así, largas cadenas; algunas moléculas de ácidos nucleicos llegan a alcanzar tamaños gigantescos, con millones de nucleótidos encadenados. Los ácidos nucleicos almacenan la información genética de los organismos vivos y son los responsables de la transmisión hereditaria. Existen dos tipos básicos, el ADN y el ARN. El descubrimiento...

1536  Palabras | 7  Páginas

Leer documento completo

Ácidos Nucleícos

ÁCIDOS NUCLEÍCOS  Los ácidos nucleicos son grandes polímeros formados por la repetición de monómeros denominados nucleótidos, unidos mediante enlaces fosfodiéster. Se forman, así, largas cadenas; algunas moléculas de ácidos nucleicos llegan a alcanzar tamaños gigantescos, con millones de nucleótidos encadenados. Los ácidos nucleicos almacenan la información genética de los organismos vivos y son los responsables de la transmisión hereditaria. Existen dos tipos básicos, el ADN y el ARN. El descubrimiento...

1435  Palabras | 6  Páginas

Leer documento completo

Acidos Nucleicos

Ácidos nucleicos Características Son compuestos organicos de elevado peso molecular formados por carbono, hidrogeno, oxigeno, nitrógeno y fosforo. Los ácidos nucleicos están constituidos por cinco tipos de moléculas denominadas nucleótidos. Éstos son la adenina (A), la citosina (C), la guanina (G), el uracilo (U) y la timina (T).       Existen dos tipos de ácidos nucleicos: el ácido desoxirribonucleico (ADN) y el ácido ribonucleico (ARN). El ADN tiene como misión dirigir las funciones vitales...

1271  Palabras | 6  Páginas

Leer documento completo

Acidos Nucleicos

Acidos nucleicos. Los ácidos nucleicos son macromoléculas, polímeros formados por la repetición de monómeros llamadosnucleótidos, unidos mediante enlaces fosfodiéster. Se forman, así, largas cadenas o polinucleótidos, lo que hace que algunas de estas moléculas lleguen a alcanzar tamaños gigantes (de millones de nucleótidos de largo). El descubrimiento de los ácidos nucleicos se debe a Friedrich Miescher, quien en el año 1869 aisló de losnúcleos de las células una sustancia ácida a la que llamó nucleína...

841  Palabras | 4  Páginas

Leer documento completo

Acidos nucleicos

ÁCIDOS NUCLEICOS DEFINICIÓN: Son biomoléculas pentarias (C, H, O, N y P) que almacenan y transmiten la información genética. El conocimiento de la estructura de los ácidos nucleicos permitió la elucidación del código genético, la determinación del mecanismo y control de la síntesis de las proteínas y el mecanismo de transmisión de la información genética de la célula madre a las células hijas, los ácidos nucleídos son macromoléculas, polímeros formados por la repetición de monómeros llamados...

596  Palabras | 3  Páginas

Leer documento completo

Acido nucleicos

levadura -Reconocer los componentes estructurales del ARN y ADN. FUNDAMENTO: Los ácidos nucleicos son compuestos nitrogenados de elevado peso molecular que se pueden encontrar en las células asociados a proteínas formando complejos llamados núcleo-proteínas. Estas proteínas tienen carácter básico mientras que los ácidos nucleicos son ácidos. Se conocen dos grupos de ácidos nucleicos: RNA (ácido ribonucleico) y el DNA (ácido desoxirribonucleico). La hidrólisis controlada de RNA y DNA produce nucleótidos...

1071  Palabras | 5  Páginas

Leer documento completo

acidos nucleicos

Proteínas y Ácidos Nucleicos 4 de diciembre 2012 [Escriba aquí una descripción breve del documento. Una descripción breve es un resumen corto del contenido del documento. Escriba aquí una descripción breve del documento. Una descripción breve es un resumen corto del contenido del documento.] Autoevalución   CUESTIONARIO. 1. ¿Cuántos son el total los monómeros de las proteínas de los seres vivos? 2. ¿Cómo se llama la unión entre los monómeros de las proteínas? 3. ¿Cuál es la importancia...

1251  Palabras | 6  Páginas

Leer documento completo

ACIDO NUCLEICO

ACIDO NUCLEICO Reynaga perez arlet Velazquez campos wendy Cach escamilla rosita Chac pech amayrani ACIDO NUCLEICO Los ácidos nucleicos son grandes polímeros formados por la repetición de monómeros denominados nucleótidos, unidos mediante enlaces fosfodiéster. Se forman, así, largas cadenas; algunas moléculas de ácidos nucleicos llegan a alcanzar tamaños gigantescos, con millones de nucleótidos encadenados. Los ácidos nucleicos almacenan la información genética de los organismos vivos y son los...

646  Palabras | 3  Páginas

Leer documento completo

Acidos nucleicos

ACIDOS NUCLEICOS Ácidos nucleicos • Funciones: • Depositarios de información genética • Transmisión de información genética de padres a hijos • Fundamentales en la síntesis proteica Nucleótidos Son unidades estructurales ácidos nucleicos, están formadas por: • Base nitrogenada • Monosacárido de 5 carbonos • Acido orto fosfórico FUNCIONES DE LOS NUCLEÓTIDOS Son fundamentales para la vida de las células, pues al unirse con otras moléculas cumplen tres funciones cruciales: TRANSPORTAN...

714  Palabras | 3  Páginas

Leer documento completo

ACIDOS NUCLEICOS

Ácido nucleico Este artículo o sección necesita referencias que aparezcan en una publicación acreditada, como revistas especializadas, monografías, prensa diaria o páginas de Internet fidedignas. Puedes añadirlas así o avisar al autor principal del artículo en su página de discusión pegando: {{subst:Aviso referencias|Ácido nucleico}} ~~~~ Representación 3D del ADN. Los ácidos nucleicos son grandes polímeros formados por la repetición de monómeros denominados nucleótidos, unidos mediante enlaces...

1542  Palabras | 7  Páginas

Leer documento completo

ácidos nucleicos

Ácidos nucleícos Genaralidades y estructura quimica Los ácidos nucleícos son macromoléculas, polímeros formados por la repetición de monómeros llamados nucleótidos. Se forman, así, largas cadenas o polinucleótidos, lo que hace que algunas de estas moléculas lleguen a alcanzar tamaños gigantes (de millones de nucleótidos de largo). Los nucleótidos están formados por una base nitrogenada, un grupo fosfato y un azúcar; ribosa en caso de ARN y desoxiribosa en el caso de ADN. El conocimiento de la...

581  Palabras | 3  Páginas

Leer documento completo

Acidos Nucleicos

|   | | | Acido nucleico, Acidos nucleicos: | Los ácidos nucleicos son grandes moléculas formadas por la repetición de un monómero llamado nucleótido. Estos se unen entre sí por un grupo fosfato, formando largas cadenas. Pueden alcanzar tamaños gigantes, siendo las moléculas más grandes que se conocen, constituídas por millones de nucleótidos. Los ácidos nucleicos almacenan la información genética de los organismos vivos y son las responsables de su transmisión hereditaria. Existen dos...

1702  Palabras | 7  Páginas

Leer documento completo

Ácidos Nucléicos

UNIVERSIDAD AUTÓNOMA DE AGUSACALIENTES DEPARTAMENTO DE QUÍMICA MEDICINA VETERINARIA ZOOTECNISTA BIOQUÍMICA “ÁCIDOS NUCLEICOS” DANIELA SOUZA QUINTERO MA. DEL ROSARIO MONTOYA GARCÍA 7-NOVIEMBRE-2014 Los ácidos nucleicos (AN) son polímeros formados por bases orgánicas, azúcares y ácido fosfórico; su PM es muy variable pero, en algunos, llega a ser de cientos de millones de daltons, siendo las macromoléculas más largas encontradas en los seres vivos. También son las de función biológica más...

1666  Palabras | 7  Páginas

Leer documento completo

Acido nucleico

Ácido nucleico Representación 3D del ADN. Los ácidos nucleicos son grandes polímeros formados por la repetición de monómeros denominados nucleótidos, unidos medianteenlaces fosfodiéster. Se forman, así, largas cadenas; algunas moléculas de ácidos nucleicos llegan a alcanzar tamaños gigantescos, con millones de nucleótidos encadenados. Los ácidos nucleicos almacenan la información genética de los organismos vivos y son los responsables de la transmisión hereditaria. Existen dos tipos básicos...

1445  Palabras | 6  Páginas

Leer documento completo

Acidos Nucleicos

Acidos nucleicos Los ácidos nucleicos son grandes polímeros formados por la repetición de monómeros denominados nucleótidos, unidos mediante enlaces fosfodiéster. Se forman, así, largas cadenas; algunas moléculas de ácidos nucleicos llegan a alcanzar tamaños gigantescos, con millones de nucleótidos encadenados. Los ácidos nucleicos almacenan la información genética de los organismos vivos y son los responsables de la transmisión hereditaria. Existen dos tipos básicos, el ADN y el ARN. El descubrimiento...

1478  Palabras | 6  Páginas

Leer documento completo

acido nucleicos

ACIDOS NUCLEICOS SON POLÍMEROS CONSTITUÍDOS POR LA UNIÓN MEDIANTE ENLACES QUÍMICOS DE UNIDADES MENORES LLAMADAS NUCLEÓTIDOS SON COMPUESTOS DE ELEVADO PESO MOLECULAR , ES DECIR MACROMOLÉCULAS LOS NUCLEÓTIDOS Están formados por: Una base nitrogenada BN Un azúcar (pentosa) A Ácido fosfórico (H3PO4) P Unidos en el siguiente orden: P A BN LOS NUCLEÓTIDOS NUCLEÓTIDO Bases Nitrogenadas Las bases nitrogenadas son compuestos orgánicos cíclicos, que incluyen dos o más...

994  Palabras | 4  Páginas

Leer documento completo

ACIDOS NUCLEICOS

ACIDOS NUCLEICOS Definición Los Ácidos Nucleicos son las biomoléculas portadoras de la información genética. Son biopolímeros, de elevado peso molecular, formados por otras subunidades estructurales o monómeros, denominados Nucleótidos. Desde el punto de vista químico, los ácidos nucleicos son macromoléculas formadas por polímeros lineales de nucleótidos, unidos por enlaces éster de fosfato, sin periodicidad aparente. Son las moléculas que tienen la información genética de los organismos y son...

1105  Palabras | 5  Páginas

Leer documento completo

acidos nucleicos

 ACIDOS NUCLEICOS Los ácidos nucleicos son grandes polímeros formados por la repetición de monómeros denominados nucleótidos, unidos mediante enlaces fosfodiéster. Se forman, así, largas cadenas; algunas moléculas de ácidos nucleicos llegan a alcanzar tamaños gigantescos, con millones de nucleótidos encadenados. Los ácidos nucleicos almacenan la información genética de los organismos vivos y son los responsables de la transmisión hereditaria. Existen dos tipos básicos, el ADN y el ARN. Existen...

1395  Palabras | 6  Páginas

Leer documento completo

Acido nucleico

Los ácidos nucleicos (AN) fueron descubiertos por Freidrich Miescher en 1869. Freidrich Miescher En la naturaleza existen solo dos tipos de ácidos nucleicos: El ADN (ácido desoxirribonucleico) y el ARN (ácido ribonucleico) y están presentes en todas las células. Su función biológica no quedó plenamente confirmada hasta que Avery y sus colaboradores demostraron en 1944 que el ADN era la molécula portadora de la información genética. Los ácidos nucleicos tienen al menos dos funciones:...

1400  Palabras | 6  Páginas

Leer documento completo

Conviértase en miembro formal de Buenas Tareas

INSCRÍBETE - ES GRATIS