• La vida del hombre neandertal
    La vida del hombre Neandertal Neandertales son los seres humanos prehistóricos que vivieron en Europa, el Oriente Medio, y Asia occidental desde alrededor de 200.000 a 28.000 años atrás. Científicamente, son generalmente clasificados como una especie separada denominada Homo neanderthalensis. Aunque...
    1078 Palabras 5 Páginas
  • La vida, evolucion y adaptacion del hombre de neandertal
    La vida, evolución y adaptación del hombre de Neandertal Introducción En este reporte a lo que quiero llegar es que veamos que hasta en tiempo de las cavernas en donde ni siquiera tenían casas o un lenguaje adecuado aunque fuera hace 35 millones de años la ciencia y la tecnología ya existía, uno...
    1183 Palabras 5 Páginas
  • Hombre De Neandertal
    HOMBRE DE NEANDERTAL El Hombre de Neandertal o simplemente Neandertal es una especie del género Homo que habitó Europa y partes de Asia occidental desde hace 230 mil hasta 29 mil años atrás, durante el Paleolítico medio. Sus características definidoras, a partir de los huesos fósiles descubiertos hasta...
    1015 Palabras 5 Páginas
  • el hombre neandertal
    La vida del hombre Neandertal Neandertales son los seres humanos prehistóricos que vivieron en Europa, el Oriente Medio, y Asia occidental desde alrededor de 200.000 a 28.000 años atrás. Científicamente, son generalmente clasificados como una especie separada denominada Homo neanderthalensis. Aunque...
    285 Palabras 2 Páginas
  • El Hombre De Neandertal
    tagtgattacagcatcattttaggctaaacgcccttaatcaggg El amor Ilustraciones: Raziel Méndez del Pleist ¿Tenemos en los tiempos oceno genes de neanderTal? Alicia García Bergua Comparando el genoma del neandertal con los genomas completos de cinco seres humanos actuales de distintas regiones, se ha descubierto que los europeos...
    2658 Palabras 11 Páginas
  • Hombre De Neandertal
    Hombre de Neandertal Rango temporal: 0,23 Ma-0,028 Ma PreЄ Є O S D C P T J K Pg N ↓ Pleistoceno Medio - Superior Reconstrucción de un esqueleto de neandertal. Estado de conservación Extinto en época prehistórica desde ca.28 000 a. C. Clasificación científica Reino: Animalia ...
    7254 Palabras 30 Páginas
  • hombre neandertal
    El hombre de Neandertal (Homo neanderthalensis) es una especie extinta del género Homo que habitó Europa y partes de Asia occidental desde hace 230.000 hasta 28.000 años atrás, durante el Pleistoceno medio y superior y culturalmente integrada en el Paleolítico medio. En un periodo de aproximadamente...
    2681 Palabras 11 Páginas
  • Hombre del neandertal
    PRIMER TRIMESTRE: HOMBRE NEANDERTAL, CUADRO COMPARATIVO. Ewgfrrjkfghsdkgbksdjhkjdhjkhfksdjhfkjdhfjdhfjdhfjhdfjdhjfhdjfheouirntiubosajbnvolsdoiosdnslkgbsudbgouihrgledkjdkhdjg df gf f f f f f lkd d d f j ue i oa hdo os eh e eh hioa como estas , jsdjs me me me e me em mira lo ke estoi ahviendo para...
    270 Palabras 2 Páginas
  • Hombre De Neandertal
    El hombre de Neandertal es una especie extinta del género Homo. Surgieron hace unos 230.000 años, en el Paleolítico, y se extinguieron hace aproximadamente 30.000 años. El inicio de la paleo antropología empieza con la historia del Homo Neanderthalensis. En agosto del 1856, en la cueva Fedhofer del...
    404 Palabras 2 Páginas
  • hombre neandertal
    NEANDERTAL ¿QUE ES UN HOMBRE NEANDERTAL? Se extinguió hace unos 30.000 años; Su estructura ósea indica una estatura de 1,60 m Se lo ha considerado más tosco y primitivo de lo que parece haber sido En un laboratorio situado en los niveles superiores del Museo de Historia Natural de esta ciudad,...
    3679 Palabras 15 Páginas
  • El hombre de neandertal
    El hombre de Neandertal (Homo neanderthalensis) es una especie extinta del género Homo que habitó Europa y partes de Asia occidental desde hace 230000 hasta 28 000 años atrás, durante el Pleistoceno medio y superior y culturalmente integrada en el Paleolítico medio. En un periodo de aproximadamente...
    330 Palabras 2 Páginas
  • El Hombre Neandertal
    afecta negativamente a la comunidad y no me refiero solo al costo económico, también al de la salud por lo tanto afectando también nuestra calidad de vida. Este gran desequilibrio también afecta directamente a los animales porque cambia o trasforma su hábitat, esto puede presentarse de maneras diferentes...
    588 Palabras 3 Páginas
  • El Hombre Neandertal
    El hombre de Neandertal (Homo neanderthalensis) es una especie extinta del género Homo que habitó Europa y partes de Asia occidental desde hace 230 000 hasta 28 000 años atrás. Los neandertales surgen a partir de una evolución local de las poblaciones humanas del Pleistoceno medio europeo. Son una especie...
    695 Palabras 3 Páginas
  • El Hombre Neandertal
    sapiens sapiens (que significa "hombre que piensa"), también llamado hombre de Cro-Magnon. Este nombre hace referencia al refugio rocoso en territorio francés, donde se hallaron esqueletos de esta especie en 1868. Y, asimismo, constituye el antecedente directo del hombre actual. Ambas subespecies convivieron...
    950 Palabras 4 Páginas
  • El hombre de Neandertal
    El hombre de Neandertal [1] (Homo neanderthalensis) es una especie extinta del género Homo que habitó Europa y partes de Asia occidental desde hace 230 000 hasta 28 000 años atrás, durante el Pleistoceno medio y superior y culturalmente integrada en el Paleolítico medio. En un periodo de aproximadamente...
    456 Palabras 2 Páginas
  • Hombre Neandertal Y Cromañon
    Hombre Neandertal Origen El hombre de Neandertal (Homo neanderthalensis) es una especie extinta del género Homo que habitó Europa y partes de Asia occidental desde hace 230 000 hasta 28 000 años atrás, durante el Pleistoceno medio y superior y culturalmente integrada en el Paleolítico medio. El término...
    1760 Palabras 8 Páginas
  • diferencias entre el hombre cromañon y neandertal
    Características de migración Regiones en las que se han encontrado restos fósiles Neandertales 100,000 años antes de nuestra era Se dedicaban a la caza, la recolección y la pesca. Confeccionaban herramientas de piedra, Los neandertales emigran la parte europea a la asiática puesto que los fósiles fueron encontrados...
    338 Palabras 2 Páginas
  • Diferencias entre el hombre de neandertal y cromagnon.
    Trabajo Teórico * Diferencias entre el hombre de Neandertal y Cromagnon. Los científicos creen que el primer ser vivo en la Tierra fue un organismo unicelular que existió hace casi cuatro millones de años. De este organismo evolucionaria la vida animal y vegetal. Finalmente, hace sólo cinco...
    1484 Palabras 6 Páginas
  • El Hombre Cro-Magnon Y Neandertal
    HOMBRE CRO-MAGNON Hombre de Cro-Magnon es el nombre con el cual se suele designar al tipo humano correspondiente a ciertos fósiles de Homo sapiens, en especial los asociados a las cuevas de Europa en las que se encontraron pinturas rupestres. Cro-Magnon es la denominación local de una cueva francesa...
    1032 Palabras 5 Páginas
  • Diferencias Entre El Hombre De neanDertal y Cromañón
    Hombre de Cro-Magnon, por un lado, es el nombre con el cual se designó al tipo humano correspondiente a ciertos fósiles de Homo sapiens, en especial los asociados a las cuevas de Europa en las que se encontraron pinturas rupestres. Cro-Magnon es la denominación local de una cueva francesa en la que se...
    763 Palabras 4 Páginas