Genetica

Solo disponible en BuenasTareas
  • Páginas : 3 (532 palabras )
  • Descarga(s) : 0
  • Publicado : 9 de octubre de 2010
Leer documento completo
Vista previa del texto
Practica Genética General BIO 204 Laboratorio 4

Bases de datos génicas

Objetivos

• Familiarizar al estudiante con las distintas bases de datos on-line, para obtener secuencias deacidos nucleicos, proteínas; como herramienta fundamental para la investigación en el area de genética

• Aplicar los conocimientos adquiridos para manipular secuencias de nucleótidosdeterminadas

Metodología

Acceder a las siguientes páginas

• PubMed: http://www.ncbi.nlm.nih.gov/entrez/query.fcgi [pic]

En esta pagina ir a nucleotide >> colocar la secuencia que se deseaencontrar y copiar las secuencias en formato FASTA y copiar a un documento en MS Word

[pic]

• Sequence Manipulation Site:

• http://www.ualberta.ca/~stothard/javascript/

[pic]

En estapágina se debe traducir la secuencia que se desea analizar, ORF, peso molecular del DNA y de la proteína codificada. ¿Son lógicos los resultados encontrados?

• Primer 3:http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi

[pic]

• Clustalw: http://clustalw.genome.jp/

[pic]

En Clustal W comparer 2 secuencias del mismo gen en 2 especies diferentes (de la mismaFamilia)

• BLAST-Homepage: http://www.ncbi.nlm.nih.gov/BLAST/

• [pic]

Colocar los primers que se han encontrado en el “Primer 3” y discutir si seria un buen primer (cebador)

Bostaurus myelin/oligodendrocyte glycoprotein mRNA sequence

>gi|399575|gb|L21757.1|BOVMOG Bos taurus myelin/oligodendrocyte glycoprotein mRNA sequenceGACAGTGGAGATGGCCAGTTTATTGAGCTCCTCTCTGCCCAGCTGTCTCCCCTCCCTCCT

CTTCCTCCTC
CTCCAGTTGACTTCCAGCTCTGCAGGACAGTTCAGAGTAATAGGACCAGGGCACCCCATC

CGGGCGCTGG
TAGGGGATGAAGTGGAATTGCCCTGTCGCATATCTCCAGGAAAGAACGCTACAGGCATGG

AGGTGGGATGGTATCGGCCCCCCTTCTCCAGGGTGGTTCATCTCTACCGAAATGGCAAGGACCAAGACGA

AGAGCAGGCA
CCTGAATACCGGGGCCGCACACAGCTGCTAAAAGAGACCATTGGGGAAGGGAAGGTGACC

CTCAGGATCC
GGAATGTGAGGTTCTCAGATGAAGGAGGTTTTACCTGCTTCTTCCGAGATCACTCTTACC...
tracking img