Transcrptomica

Solo disponible en BuenasTareas
  • Páginas : 3 (595 palabras )
  • Descarga(s) : 0
  • Publicado : 10 de septiembre de 2012
Leer documento completo
Vista previa del texto
Taller N° 2

TRANSCRIPTÓMICA

Diagnóstico Clínico y Molecular

INTRODUCCIÓN
Frente a las exigencias a las que es sometido el cerebro en cada minuto del día, debe abastecerse de energía parapoder cumplir con éstas, dada la importancia que a éste órgano se le confiere en el funcionamiento normal de nuestro organismo, o también en condiciones de adaptación al medio externo.
De esta forma,el combustible de preferencia de las neuronas es la glucosa, pero dado que el almacenamiento de glucógeno en éstas es escaso, dependen de la glucosa que les proporciona el torrente sanguíneo.
“Estaglucosa procede del hígado, en el ayuno prolongado el cerebro consume 2/3 de la glucosa que el hígado produce, alcanzando este consumo 100 grs, de glucosa al día. Si el nivel de glucosa desciende pordebajo de un nivel crítico, aun siendo este descenso poco duradero, pueden aparecer síntomas de alteraciones cerebrales que resulten graves incluso lleguen a ser en ocasione s irreversibles”. (1)Como segunda opción y ya en situaciones más críticas de los niveles de glucosa, el cerebro puede metabolizar cuerpos cetónicos como el ácido β-hidroxibutírico.
“Este acido se va a producir a nivelhepático cuando exista degradación masiva de ácidos grasos libres procedentes de la movilización de reservas de triglicéridos del tejido adiposo”. (2)
La glucosa en el interior de las célulasneuronales es fosforilada por la enzima hexoquinasa que tiene un gran afinidad por ésta.
“La glucosa-6-fosfato se degrada por la via glicolítica aerobia hasta CO2 y H2O para lo que requiere un aportecontinuo de oxigeno”. (3)

DESARROLLO Y RESULTADOS
* La siguiente secuencia de RNAm corresponde a un transcrito de una enzima humana de cerebro.gccactggccccacacctgcttctccgcatcccccaccgtcaacatgatcgccgcgcaactactggcatattacttcaccgagctgaaggatgaccaagtcaaaaagattgataagtatc

Figura 1. Secuencia de RNAm transcrito de una enzima humana de cerebro.
* Se utilizó la página web...
tracking img