Nebcutter

Solo disponible en BuenasTareas
  • Páginas : 5 (1149 palabras )
  • Descarga(s) : 0
  • Publicado : 6 de noviembre de 2010
Leer documento completo
Vista previa del texto
ESCUELA POLITÉCNICA DEL EJÉRCITO
INGENIERÍA EN BIOTECNOLOGÍA
BIOLOGÍA MOLECULAR III

TRABAJO

Nombre: Isaac Armendáriz Castillo
Curso: Cuarto “ B”
Fecha: 28 - septiembre - 2010

TEMA: Utilizar el programa NEBcutter V2.0

UTILIZANDO NEBcutter ANALIZAR LAS ENZIMAS DE RESTRICCIÓN QUE CORTAN LAS SECUENCIAS DE ADN.



SECUENCIA ENTREGADA

1 gacttaattg gattgagccttggtatggaa acctaccaag tgataacttt caaattcaga 61
gaaaccctgg aattaaaaat gggcaatcct gagccaaatc ccgttttatg aaaacaaaca 121
aggatttcac aaagcgagaa taaataaagg ataggtgcag agactcaatg gaagctgttc 181
taagagatgg agttggctgc actttgttcg taaaggaatc cttccatcaa aactttccga 241
aaggatgaaa gataaaccta tagacatatg tatacttatc gccaaattat tcaaaataat 301
taatgacgac tccaaccggt tctataattt ttttatatct atttttatgaaaaataaaag 361
aatttttttg aatcgattca aaataaaaat tgaaaaaaga attaaatatt cattgatcaa 421
atcattcact ccatcatagt ctgataaatc tttttatttt tcagaattga ttaatcggat 481
aagaataaag atagagtccc attctacatg tcaatatcga caacaatgaa atttatagta 541
agaggaaaat ccgtcgactt tagaaatcgt gagggttcaa gtccctctat ccccaaaaac 601
caggttgccg cctcaattat ttatcttctg attttgttcg tgactcaaaa tgggttacgg 661
ttctcaatca ttctcactttattatttcac aaaccgatcg gtgcggaaat ttttttcatc 721
ataagccttg ggtgtgatat tgatatatat catacatgtc caaatgcaaa tgagcatctt 781
tgactaatgt attacaatta ataatccatg tcattatttg tattatttgg actgtattga 841
aacttacaaa gttttctttt taaagataca agaaattcta ccagggccgg gataatactt 901
tgtaatatct tttggttttt tttaattgac atagacccaa gtcctatatt aaaataaaat 961
gaggatggtg cgtcgtgaat ggtcgggata gctcagctgg tagagcagag gactgaaaat 1021Simbología de los colores y signos usados por el programa NEB cutter para señalar el tipo de corte, la extensión de cada enzima, si están afectadas por otro factor y si están disponibles comercialmente.


























En esta figura se observan todas las enzimas de restricción que cortan una sola vez la cadena de ADN deesta secuencia.
Por la información que tenemos sabemos que todas las enzimas mostradas están disponibles en NEB, hay 10 enzimas que presentan cortes romos, mientras todas las demás tienen cortes pegajosos, 21 enzimas tienen extensión 5´, 7 enzimas tienen extensión 3´, las enzimas que están marcadas por un * están afectadas por metilación CpG y las que están marcadas con el signo # estánafectadas por otro tipo de metilación.


SECUENCIA ESCOGIDA: Homo sapiens neanderthalensis mitochondrial genome.

1 gatcacaggt ctatcaccct attaaccact cacgggagct ctccatgcat ttggtatttt
61 cgtctggggg gtgtgcacgc gatagcattg cgagacgctg gagccggagc accctatgtc
121 gcagtatctg tctttgattc ctgcctcatt ctattattta tcgcacctac gttcaatatt
181 acagacgagc atacttacta aagtgtgttaattaattaat gcttgtagga cataataata
241 acgattaaat gtctgcacag ccgctttcca cacagacatc ataacaaaaa atttccacca
301 aacccccccc cccccgcttc tggccacagc acttaaacac atctctgcca aaccccaaaa
361 acaaagaacc ctaacaccag cctaaccaga tttcaaattt tatcttttgg cggtatacac
421 ttttaacagt caccccctaa ctaacacatt attttcccct cccactccca tactactaat
481 ctcatcaata caacccccgc ccatcctacc cagcacacaccgctgctaac cccatacccc
541 gagccaacca aaccccaaag acacccccca cagtttatgt agcttacctc ctcaaagcaa
601 tacactgaaa atgtttagac gggctcacat caccccataa acaaataggt ttggtcctag
661 cctttctatt agctcttagt aagattacac atgcaagcat ccccattcca gtgagttcac
721 cctctaaatc accacgatca aaagggacaa gcatcaagca cgcaacaatg cagctcaaaa
781 cgcttagcct agccacaccc ccacgggaaa cagcagtgat aagcctttagcaataaacga
841 aagtttaact aagctatact aaccccaggg ttggtcaatt tcgtgccagc caccgcggtc
901 acacgattaa cccaagtcaa tagaagccgg cgtaaagagt gttttagatc accccctccc
961 caataaagct aaaactcacc tgagttgtaa aaaactccag ttgacacaaa ataaactacg
1021 aaagtggctt taacatatct gaacacacaa tagctaagac ccaaactggg attagatacc














En esta figura se observan todas...
tracking img