trabajos

Solo disponible en BuenasTareas
  • Páginas: 6 (1352 palabras)
  • Descarga(s): 0
  • Publicado: 20 de agosto de 2013
Leer documento completo
Vista previa del texto
El ácido desoxirribonucléico, comúnmente conocido como DNA, tiene dos cadenas enrolladas en una estructura de doble hélice. Dentro de esta doble hélice está el proyecto de un organismo completo, ya sea una célula simple o un ser humano. En el ADN, cada secuencia de cadenas de bases es un complemento a su secuencia de cadena del compañero.
Químicos
Por todas las complejidades del ADN, todosobre la información genética está contenido dentro de cuatro elementos químicos diferentes: adenina (A), citosina (C), guanina (G), tiamina (T). También llamados "nucleótidos", estos monómeros están compuestos de una molécula de azúcar, un grupo de fosfatos y una base de nitrógeno unida por lazos covalentes.
Genes
En la larga cadena del ADN, estos cuatro químicos juntos en diferentes secuencias sonllamados genes. Estas subunidades individuales de la cadena de ADN dictan los atributos fisiológicos del organismo para el cual el ADN es un proyecto. Cada gen tiene una secuencia única y un número de nucleótidos.
Cadenas complementarias
La doble hélice del ADN, funciona para que los nucleótidos de cada cadena de ADN no sean exactamente iguales: en su lugar, son cadenas complementarias conbases de nucleótidos complementarios. Esto es, cada nucleótido es siempre emparejado con otro nucleótido específico en la cadena opuesta. Específicamente, la adenina (A) siempre estará complementada con la tiamina (T) en la cadena opuesta y la citosina (C) con la guanina (G) en la cadena opuesta.
Mitosis
El sistema de bases complementario es una parte importante de la mitosis de las células dondeuna célula se divide en dos. Parte de este proceso involucra las células de ADN, almacenadas en el núcleo, formando una doble hélice en dos cadenas separadas de nucleótidos. Estas dos cadenas separadas usan nucleótidos gratis del núcleo para reconstruir la cadena perdida: cada nucleótido en la cadena existente, se empareja con su nucleótido complementario. Las enzimas forman estos en una nuevacadena de ADN. El resultado es que cada cadena que surge de una doble hélice es ahora un complemento de la estructura de la doble hélice.







ARN-M
5' AA-AUC-AAU-UCU-GUG-AAC-GAU-AAU-CCA-GUC-AUU-GAU-GUU-GCC-AGA-GAC-AAA-GCU- 3'
Poli-3 NH2-Ile-Asn-Ser-Val-Asn-Asp-Asn-Pro-Val-Ile-Asp-Val-Ala-Arg-Gln-Ser-.....
Por último, realizaremos la traducción del mensajero correspondiente a la hélice denueva síntesis, complementaria a la molde (ARN-C).
ARN-C 3' UUUAGUUAAGACACUUGCUAUUAGGUCAGUAACUACAACGCUCUCUGUUUCGA  5'
Para ello primero, colocaremos la secuencia del mensajero ARN-C en la dirección de traducción, es decir de 5' a 3'.
ARN-C 5' AGCUUUGUCUCUCCGCAACAUCAAUGACUGGAUUAUCGUUCACAGAAUUGAUUU 3'
Utilizando de nuevo el código genético y comenzando la traducción por el extremo 5' que secorresponde con el extremo amino (NH2) del polipéptido, se obtienen las siguientes secuencias de aminoácidos.
Comenzando por la primera Adenina







4. Tipos de ácidos nucleicos Existen dos tipos de ácidos nucleicos: ADN (ácido desoxirribonucleico) y ARN (ácido ribonucleico), que se diferencian: por el glúcido ( pentosa ) que contienen: la desoxirribosa en el ADN y la ribosa en el ARN; porlas bases nitrogenadas que contienen: adenina , guanina , citosina y timina , en el ADN; adenina, guanina, citosina y uracilo , en el ARN; en los organismos eucariotas , la estructura del ADN es de doble cadena, mientras que la estructura del ARN es monocatenaria, aunque puede presentarse en forma extendida, como el ARNm 
Importancia del código genetico
Es fundamental, el código genético (casisiempre correspondiente a la molécula llamada ADN aunque en organismos primitivos puede ser el ARN) es una gran molécula que posee genes, cada gen puede servir para crear una parte (por ínfima que sea) del organismo, diciéndolo a lo bestia: existen genes para que se produzcan los brazos, los ojos etc.

Por lo demás los caracteres evidentes (color de piel, tipo de cabello, etc) son determinados...
tracking img