• El Amor En Los Tiempos Del Pleistoceno
    atcattttaggctaaacgcccttaatcaggg agtttagtgattacagcatcattttaggctaa tagtgattacagcatcattttaggctaaacgcccttaatcaggg El amor Ilustraciones: Raziel Méndez del Pleist ¿Tenemos en los tiempos oceno genes de neanderTal? Alicia García Bergua Comparando el genoma del neandertal con los genomas...
    2658 Palabras 11 Páginas
  • El Amor en Tiempos del Pleistoceno
    catcattttaggctaaacgcccttaatcaggg agtttagtgattacagcatcattttaggctaa ttagtgattacagcatcattttaggctaaacgcccttaatcaggg El amor Ilustraciones: Raziel Méndez del Pleist ¿Tenemos en los tiempos oceno genes de neandertal? Alicia García Bergua Comparando el genoma del neandertal con los genomas...
    2688 Palabras 11 Páginas
  • El amor en los tiempos del pleistoceno
    El amor en los tiempos del Pleistoceno. El artículo publicado en la revista ¿Cómo ves? revista de divulgación científica de la UNAM (Universidad Nacional Autónoma de México) con el título “El amor en los tiempos del Pleistoceno”, autoría de Alicia García Bergua, plantea la relación humana y reproductiva...
    871 Palabras 4 Páginas
  • El amor en los tiempos de pleistoceno
    . Yo pienso que van entrelazados por que el aprendizaje es el objetivo principal porque el fin en obtener nuevos cocimientos 2. Retoma el cuadro que realizaste en la Actividad 4 y realiza lo siguiente: * Agrega las columnas necesarias para que incluyas los temas aprendizaje significativo...
    702 Palabras 3 Páginas
  • El amor en los tiempos del pleistoceno
    Evidencia de aprendizaje. Unidad 3 Rosa Linda Caraveo Vega Cuadro sinóptico El amor en los tiempos del pleistoceno ¿Tenemos genes de Neandertal? Los neandertales no son antepasados nuestros, como alguna vez se pensó, sino primos. Los neandertales colonizaron el medio oriente, Europa y Asia...
    1017 Palabras 5 Páginas
  • Esad amor en tiempos del pleistoceno
    CHIMPANCÉ Comparte HOMO NEANDERTAL Indicios Extinción HOMO SAPIENS Posible encuentro Posible encuentro Colonizaron Medio oriente Epoca-Tiempo Podían hablar Indicios 30,000 de años Oceánia Hace 80,000 Coincidencia Herramientas de piedra Convivencia 10,000 años Primera...
    435 Palabras 2 Páginas
  • El amor en los tiempos de pleistoceno
    conveniente señalar que su existencia estará condicionada al campo de las relaciones sociales donde se pretende establecer determinada conducta, al tiempo| |en el que debe ser observada y a los sujetos a quienes va dirigida. ...
    3222 Palabras 13 Páginas
  • Amor En Tiempos Del pleistocEno
    Unidad 3. Autorregulación Uriel Márquez Chávez EL AMOR EN LOS TIEMPOS DEL PLEISTOCENO ¿Tenemos genes de Neandertal? En África Hace 600,000 años 130 000 años Hace 30 000 años chimpancé Desciende del Ancestro común Salió de África Vivió Desciende del Antepasado ...
    363 Palabras 2 Páginas
  • El amor en los tiempos del pleistoceno
    El amor en los tiempos del  Pleistoceno ¿Tenemos genes de Neandertal? Chimpancés Antepasado común Hace 600 000 años Desciend en Homo Sapiens Hace 200 000 años Permanecieron África Neandertales Hace 60 000 años un grupo salió Coexistieron por 10 000 años Colonizaron Asia Occident al Medio...
    254 Palabras 2 Páginas
  • El amor en lo tiempos de pleistoceno
    LECTURA: NEANDERTALES Y HUMANOS. EL AMOR EN LOS TIEMPOS DEL PLEISTOCENO NEANDERTALES Y HUMANOS EL AMOR EN TIEMPOS DEL PLEISTOCENO NEANDERTALES Similitudes 99% de material genético con el HOMO SAPIENS Existen desde hace 600,000 años Colonizaron el Medio Oriente, Europa y Asia Occidental ...
    280 Palabras 2 Páginas
  • El amor en los tiempos del pleistoceno
    El amor en los tiempos del Pleistoceno, ¿tenemos genes de neandertal? (Resumen) Los neandertales no son antepasados nuestros, sino primos: ambos descendemos de un homínido africano de hace 600,000 años. Los neandertales colonizaron Europa, Medio Oriente y Asia occidental, los humanos permanecieron en...
    708 Palabras 3 Páginas
  • Mapa conceptual al amor en tiempos del pleistoceno
    entorno, considero que para que el aprendizaje sea efectivo es necesario saber aplicarlo cuando sea necesario, y además debe perdurar a través del tiempo, es un proceso por medio del cual adquirimos habilidades, conocimientos y habilidades, también forjamos actitudes e ideales. Aprender me sirve para...
    553 Palabras 3 Páginas
  • Neandertales y humanos.- el amor en los tiempos del pleistoceno
    aula, y las ocupaciones, compromisos y responsabilidades, son factores determinantes que tenemos que saber manejar y darle a cada uno de ellos, su tiempo y su espacio, sin descuidar cada uno, aparte de que debe haber un motivo para superarse, debe haber personalmente, mas organización. 5.- Finalmente...
    344 Palabras 2 Páginas
  • El enamoramiento y mal de amores cuadro sinoptico
    PARTE O CAPITULO DEL LIBRO | TITULO | IDEAS PRINCIPALES SOBRE EL TEMA | CAPITULO IX | Las señales de reclamo amoroso | La Naturaleza invento el cortejo para que los animales se busquen, se enamoren y se acoplen.La sonrisa con exhibición de los dientes superiores expresa interés y coqueteo. | | Los...
    450 Palabras 2 Páginas
  • El amor en los tiempos del pleistoceno ¿témenos genes de neandertal? el amor en los tiempos del pleistoceno ¿témenos genes de neandertal? el amor en tiempos del pleisteoceno
    se genera un Mapa Conceptual 03/03/2012 Estrategia de Estudio 4.- Después de generar el mapa conceptual, este nos ayuda a elaborar el cuadro sinóptico. 03/03/2012 ...
    568 Palabras 3 Páginas
  • Mapa conceptual nehndertales y humanos. el amor en los tiempos del pleistoceno
    todos tenemos una gran experiencia; la mía es que tengo una gran familia que espera más de mí y lo hacen porque creen en mí. Por ahora administrar mi tiempo es mi primer reto durante este curso, ya que mi trabajo me absorbe bastante. * Considero que esta opción de estudio podrá llevarme a mis objetivos...
    461 Palabras 2 Páginas
  • Cuadro sinoptico
    Las fuentes del conocimiento y la verdad ¿Cuál es el origen o la fuente del conocimiento? Algunos filósofos han defendido que conocemos mediante la experiencia la cual sólo puede ser adquirida a través de los sentidos. Esta postura se llama Empirismo. Otros, en cambio, afirman que el conocimiento...
    2218 Palabras 9 Páginas
  • Cuadro Sinoptico
    la verificación de resultados requerían aproximadamente a la mitad de la población de Estados Unidos para poder realizar los cálculos en tan corto tiempo. El director del proyecto en UCLA le contesto al Ing. Beltrán al cuestionarle sobre la rapidez de los cálculos, que estos se habían efectuado con...
    1628 Palabras 7 Páginas
  • Cuadro sinoptico
    DOF - Diario Oficial de la Federación Page 1 of 2 DOF: 30/04/2009 ACUERDO mediante el cual se ordena la suspensión de labores en la Administración Pública Federal y en el sector productivo de todo el territorio nacional, durante el periodo que comprende del 1o. al 5 de mayo del presente año...
    859 Palabras 4 Páginas
  • Cuadro Sinoptico
    Un cuadro sinóptico es una forma de expresión visual de ideas o textos ampliamente utilizados como recursos instruccionales que comunican la estructura lógica de la información. Son estrategias para organizar el contenido de conocimientos de manera sencilla y condensada. Un cuadro sinóptico es una herramienta...
    732 Palabras 3 Páginas