• Mapa conceptual nehndertales y humanos. el amor en los tiempos del pleistoceno
    todos tenemos una gran experiencia; la mía es que tengo una gran familia que espera más de mí y lo hacen porque creen en mí. Por ahora administrar mi tiempo es mi primer reto durante este curso, ya que mi trabajo me absorbe bastante. * Considero que esta opción de estudio podrá llevarme a mis objetivos...
    461 Palabras 2 Páginas
  • Neandertales y humanos.- el amor en los tiempos del pleistoceno
    metas y objetivos que he trazado para mi vida, ser mejor persona, mejor ser humano, en segundo lugar estar mejor preparado intelectual y profesionalmente para mejorar la calidad de vida que puedo tener y que cualquier ser humano desea tener. 2.- ¿Se trata de factores intrínsecos o extrínsecos? ...
    344 Palabras 2 Páginas
  • Mapa conceptual al amor en tiempos del pleistoceno
    entorno, considero que para que el aprendizaje sea efectivo es necesario saber aplicarlo cuando sea necesario, y además debe perdurar a través del tiempo, es un proceso por medio del cual adquirimos habilidades, conocimientos y habilidades, también forjamos actitudes e ideales. Aprender me sirve para...
    553 Palabras 3 Páginas
  • El amor en los tiempos del pleistoceno ¿témenos genes de neandertal? el amor en los tiempos del pleistoceno ¿témenos genes de neandertal? el amor en tiempos del pleisteoceno
    mismo antepasado que vivió en áfrica hace 600,000 años. Se crea una hipótesis Los neandertales fueron absorbidos población de humanos modernos por la Somos Primos Hermanos Descubrimiento de restos humanos Los neandertales y los hombres modernos compartimos un 99% de material genético con el chimpancé...
    568 Palabras 3 Páginas
  • Mapa conceptual neandertales
    Resumen Neandertales y humanos. El amor en los tiempos del Pleistoceno. Los neandertales no son ante pasados nuestros, sino primos, según estudios, nuestra especie y el hombre de neandertal, descienden de un antepasado común que vivió en África. Los Neandertales colonizaron el medio oriente, Europa...
    1275 Palabras 6 Páginas
  • El Amor En Los Tiempos Del Pleistoceno
    tagtgattacagcatcattttaggctaaacgcccttaatcaggg El amor Ilustraciones: Raziel Méndez del Pleist ¿Tenemos en los tiempos oceno genes de neanderTal? Alicia García Bergua Comparando el genoma del neandertal con los genomas completos de cinco seres humanos actuales de distintas regiones, se...
    2658 Palabras 11 Páginas
  • El Amor en Tiempos del Pleistoceno
    ttagtgattacagcatcattttaggctaaacgcccttaatcaggg El amor Ilustraciones: Raziel Méndez del Pleist ¿Tenemos en los tiempos oceno genes de neandertal? Alicia García Bergua Comparando el genoma del neandertal con los genomas completos de cinco seres humanos actuales de distintas regiones, se...
    2688 Palabras 11 Páginas
  • El amor en los tiempos del pleistoceno
    El amor en los tiempos del Pleistoceno. El artículo publicado en la revista ¿Cómo ves? revista de divulgación científica de la UNAM (Universidad Nacional Autónoma de México) con el título “El amor en los tiempos del Pleistoceno”, autoría de Alicia García Bergua, plantea la relación humana y reproductiva...
    871 Palabras 4 Páginas
  • Esad amor en tiempos del pleistoceno
    de neandertal Medio oriente, europa y asia occidental Vivió 600,000 años ANTEPASADO COMÚN Habitaron desde hace 200,000 años Descienden de Registro Registro Descienden de Africa 100000 años Vivió Comparte 99% material genético CHIMPANCÉ Comparte HOMO NEANDERTAL Indicios...
    435 Palabras 2 Páginas
  • El amor en los tiempos del pleistoceno
    Cuadro sinóptico El amor en los tiempos del pleistoceno ¿Tenemos genes de Neandertal? Los neandertales no son antepasados nuestros, como alguna vez se pensó, sino primos. Los neandertales colonizaron el medio oriente, Europa y Asia occidental, mientras que los humanos permanecieron en África hasta...
    1017 Palabras 5 Páginas
  • El amor en los tiempos de pleistoceno
    mental, por la cual obtenemos nuevos conocimientos. * ¿Para qué te sirve aprender? Para saber el porqué de las cosas, eso ha llevado a la humanidad a tener grandes cambios desde cualquier plano y así mejorando su calidad de vida. * ¿Qué entiendes por metacognición? Argumenta tu respuesta....
    702 Palabras 3 Páginas
  • Amor En Tiempos Del pleistocEno
    Unidad 3. Autorregulación Uriel Márquez Chávez EL AMOR EN LOS TIEMPOS DEL PLEISTOCENO ¿Tenemos genes de Neandertal? En África Hace 600,000 años 130 000 años Hace 30 000 años chimpancé Desciende del Ancestro común Salió de África Vivió Desciende del Antepasado ...
    363 Palabras 2 Páginas
  • El amor en los tiempos del pleistoceno
    El amor en los tiempos del  Pleistoceno ¿Tenemos genes de Neandertal? Chimpancés Antepasado común Hace 600 000 años Desciend en Homo Sapiens Hace 200 000 años Permanecieron África Neandertales Hace 60 000 años un grupo salió Coexistieron por 10 000 años Colonizaron Asia Occident al Medio...
    254 Palabras 2 Páginas
  • El amor en los tiempos de pleistoceno
    conveniente señalar que su existencia estará condicionada al campo de las relaciones sociales donde se pretende establecer determinada conducta, al tiempo| |en el que debe ser observada y a los sujetos a quienes va dirigida. ...
    3222 Palabras 13 Páginas
  • El amor en lo tiempos de pleistoceno
    LECTURA: NEANDERTALES Y HUMANOS. EL AMOR EN LOS TIEMPOS DEL PLEISTOCENO NEANDERTALES Y HUMANOS EL AMOR EN TIEMPOS DEL PLEISTOCENO NEANDERTALES Similitudes 99% de material genético con el HOMO SAPIENS Existen desde hace 600,000 años Colonizaron el Medio Oriente, Europa y Asia Occidental ...
    280 Palabras 2 Páginas
  • El amor en los tiempos del pleistoceno
    El amor en los tiempos del Pleistoceno, ¿tenemos genes de neandertal? (Resumen) Los neandertales no son antepasados nuestros, sino primos: ambos descendemos de un homínido africano de hace 600,000 años. Los neandertales colonizaron Europa, Medio Oriente y Asia occidental, los humanos permanecieron en...
    708 Palabras 3 Páginas
  • mapa conceptual de administracion del tiempo
    otro verbo en su forma base. ·         Para formar la interrogativa debemos invertir 'will', por lo que no necesitamos auxiliar. ·         Este tiempo suele ir acompañado de expresiones que hacen referencia al futuro, como es el caso de 'tomorrow, this weekend, next Tuesday, next month, next year...
    613 Palabras 3 Páginas
  • ESTUDIO DE TIEMPO MAPA CONCEPTUAL
    accidentes; y d) Mantengan el ambiente en condiciones satisfactorias. En consecuencia, las organizaciones tienen la obligación de brindarles a su recurso humano un ambiente laboral propicio que cumpla con las normativas de seguridad e higiene, donde éste pueda ejercer su labor de manera tal, que no perjudique...
    711 Palabras 3 Páginas
  • Mapa conceptual y linea del tiempo
    LÍNEA DE TIEMPO Estrategia en la cual se descubren las aportaciones o los acontecimientos más importantes de una época o etapa del tiempo, siguiendo una secuencia cronológica. Características * Construir una recta bidireccional dividida en segmentos * Según la lectura seleccionar las...
    304 Palabras 2 Páginas
  • Mapa conceptual tiempo
    planificas. Procura que tu familia, amigos y compañeros te ayuden a respetar el Plan. Hazlo público. Propóntelo como un reto personal. Organización del tiempo Es uno de los elementos fundamentales a la hora de empezar el día sea para realizar actividades personales de estudio o laboral, es  fundamental...
    314 Palabras 2 Páginas